Rh6AG060600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
9099903 .. 9100978
1076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG060600.1

Sequence Viewer

Length: 156 bp
ATGGTTTTCGCTACTACGCTCGCCAAATCTAGGAGAGGAGAGAGAAATTCGAGACGCTCTCTATCTCCTCCAACGGGCAAATTTGTTCAAATTCAAACCTCCAGATTAGTGCAACAGGGTCTTGGCGAGGAGACTCCTAATTGCGAGCAGCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.72

Weight (kDa)

10.75

Isoelectric Point (pI)

76.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 46, 80, 90
AfiI CCNNNNNNNGG 2 cut(s) 30, 74
AgsI TTSAA 2 cut(s) 89, 95
Alw26I GTCTC 2 cut(s) 46, 125
ApeKI GCWGC 1 cut(s) 148
ApoI RAATTY 3 cut(s) 46, 80, 90
BcoDI GTCTC 2 cut(s) 46, 125
BfaI CTAG 1 cut(s) 30
BisI GCNGC 1 cut(s) 149
BlsI GCNGC 1 cut(s) 150
BplI GAGNNNNNCTC 2 cut(s) 43, 75
BpmI CTGGAG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 2 cut(s) 30, 74
BseLI CCNNNNNNNGG 2 cut(s) 30, 74
BseRI GAGGAG 3 cut(s) 51, 57, 143
BslI CCNNNNNNNGG 2 cut(s) 30, 74
BsmAI GTCTC 2 cut(s) 46, 125
BsmBI CGTCTC 1 cut(s) 46
BstC8I GCNNGC 2 cut(s) 21, 146
BstMAI GTCTC 2 cut(s) 46, 125
Cac8I GCNNGC 2 cut(s) 21, 146
CseI GACGC 1 cut(s) 63
Esp3I CGTCTC 1 cut(s) 46
Fnu4HI GCNGC 1 cut(s) 149
Fsp4HI GCNGC 1 cut(s) 149
FspBI CTAG 1 cut(s) 30
GluI GCNGC 1 cut(s) 149
GsuI CTGGAG 1 cut(s) 85
HgaI GACGC 1 cut(s) 63
HinfI GANTC 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 51, 102
HpyCH4V TGCA 1 cut(s) 112
LpnPI CCDG 2 cut(s) 101, 115
MaeI CTAG 1 cut(s) 30
MluCI AATT 4 cut(s) 46, 80, 90, 139
MlyI GAGTC 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 4 cut(s) 29, 78, 109, 121
PkrI GCNGC 1 cut(s) 150
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
SatI GCNGC 1 cut(s) 149
SchI GAGTC 1 cut(s) 127
SetI ASST 1 cut(s) 101
SgeI CNNG 8 cut(s) 32, 42, 63, 87, 114, 128, 134, 139
Sse9I AATT 4 cut(s) 46, 80, 90, 139
SspMI CTAG 1 cut(s) 30
TaqI TCGA 1 cut(s) 50
TasI AATT 4 cut(s) 46, 80, 90, 139
TseI GCWGC 1 cut(s) 148
XapI RAATTY 3 cut(s) 46, 80, 90
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.