Rorug02G0171300

KIP1-like protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
15493235 .. 15493405
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0171300.1

Sequence Viewer

Length: 171 bp
ATGAACTTCAAATCTTCACACATATTTAGAGAAGAGAATAAGGTAGCAGATGCTCTAGCTAATCATGGAACATCTTTGTCGGAGCAAGTATGGTGGGATATGCCTCCTCCAGTTCTCTTGTCGTTCTATGAGAGTGATGTTTTGGGTCTTCCACAGTTTAGATTTCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.54

Weight (kDa)

5.45

Isoelectric Point (pI)

56.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 10
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 140
BfaI CTAG 1 cut(s) 56
BmsI GCATC 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 140
BpmI CTGGAG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 110
BseRI GAGGAG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 27
BstV2I GAAGAC 1 cut(s) 140
CspCI CAANNNNNGTGG 2 cut(s) 74, 109
CviAII CATG 1 cut(s) 65
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
FaeI CATG 1 cut(s) 68
FaiI YATR 5 cut(s) 23, 66, 91, 101, 129
FatI CATG 1 cut(s) 64
FspBI CTAG 1 cut(s) 56
GsuI CTGGAG 1 cut(s) 93
Hin1II CATG 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 156
Hsp92II CATG 1 cut(s) 68
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 123
LweI GCATC 1 cut(s) 40
MaeI CTAG 1 cut(s) 56
MboII GAAGA 3 cut(s) 6, 44, 140
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 2 cut(s) 114, 117
NlaIII CATG 1 cut(s) 68
SetI ASST 2 cut(s) 45, 61
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 5 cut(s) 68, 77, 98, 122, 130
SspMI CTAG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.