Rorug02G0339900

Severs microtubules in an ATP-dependent manner. Microtubule severing may promote rapid reorganization of cellular microtubule arrays

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
42312425 .. 42312583
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0339900.1

Sequence Viewer

Length: 159 bp
ATGAGAGATAGAGGTATTGATCTTGACACGCAATGTCCTAGATGTGATGAGGAAGTGGAATCTCCGCTGCATGCTAGGGTGGAGTGTAACGCAGCCAACGAGATACTAATCTTAATTGGCCCCAAATGGTCCGTTCCCTTTCTTGCCAAATGTTGTTAA

Protein Analysis

52

Amino Acids

5.86

Weight (kDa)

4.83

Isoelectric Point (pI)

49.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015121)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G80350
fragaria_vesca FvH4_6g30820 FvH4_6g30820
malus_domestica MD09G1216700.v1.1 MD17G1198800.v1.1
prunus_persica Prupe.3G075400_v2.0.a1
pyrus_communis pycom09g13400 pycom17g20350
rosa_chinensis RchiOBHm_Chr2g0137251
rosa_laevigata RLG00000019638
rosa_multiflora Rmu_sc0000894.1_g000020
rosa_roxburghii Rroxscaffold_2G00107270
rosa_rugosa Rorug02G0339900 Rorug02G0340000
rosa_samantha Rh2BG396400
rosa_wichuraiana Rw2G031850

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 65
AoxI GGCC 1 cut(s) 118
ApeKI GCWGC 2 cut(s) 67, 92
AspS9I GGNCC 2 cut(s) 119, 129
AvaII GGWCC 1 cut(s) 129
BbvI GCAGC 2 cut(s) 54, 104
BfaI CTAG 2 cut(s) 39, 75
BisI GCNGC 2 cut(s) 68, 93
BlsI GCNGC 2 cut(s) 69, 94
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 2 cut(s) 119, 129
BmiI GGNNCC 1 cut(s) 121
BsaBI GATNNNNATC 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 107
BseJI GATNNNNATC 1 cut(s) 107
BseMI GCAATG 1 cut(s) 38
BseXI GCAGC 2 cut(s) 54, 104
BshFI GGCC 1 cut(s) 120
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 65
BspANI GGCC 1 cut(s) 120
BspLI GGNNCC 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 38
BssMI GATC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 72
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 74
BstV1I GCAGC 2 cut(s) 54, 104
BsuRI GGCC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 72
Cfr13I GGNCC 2 cut(s) 119, 129
CviAII CATG 1 cut(s) 71
CviJI RGCY 2 cut(s) 95, 120
CviKI_1 RGCY 2 cut(s) 95, 120
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eco47I GGWCC 1 cut(s) 129
FaeI CATG 1 cut(s) 74
FaiI YATR 1 cut(s) 72
FatI CATG 1 cut(s) 70
Fnu4HI GCNGC 2 cut(s) 68, 93
Fsp4HI GCNGC 2 cut(s) 68, 93
FspBI CTAG 2 cut(s) 39, 75
GluI GCNGC 2 cut(s) 68, 93
HaeIII GGCC 1 cut(s) 120
Hin1II CATG 1 cut(s) 74
HinfI GANTC 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 70
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 1 cut(s) 19
Lsp1109I GCAGC 2 cut(s) 54, 104
MaeI CTAG 2 cut(s) 39, 75
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MluCI AATT 1 cut(s) 114
MnlI CCTC 2 cut(s) 5, 43
MseI TTAA 2 cut(s) 113, 157
MspA1I CMGCKG 1 cut(s) 67
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 74
NlaIV GGNNCC 1 cut(s) 121
NspI RCATGY 1 cut(s) 74
PaeI GCATGC 1 cut(s) 74
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PfeI GAWTC 1 cut(s) 59
PkrI GCNGC 2 cut(s) 69, 94
PspN4I GGNNCC 1 cut(s) 121
PspPI GGNCC 2 cut(s) 119, 129
SaqAI TTAA 2 cut(s) 113, 157
SatI GCNGC 2 cut(s) 68, 93
Sau3AI GATC 1 cut(s) 19
Sau96I GGNCC 2 cut(s) 119, 129
SetI ASST 1 cut(s) 16
SgeI CNNG 7 cut(s) 35, 40, 51, 83, 87, 112, 155
SinI GGWCC 1 cut(s) 129
SphI GCATGC 1 cut(s) 74
Sse9I AATT 1 cut(s) 114
SsiI CCGC 1 cut(s) 65
SspMI CTAG 2 cut(s) 39, 75
TasI AATT 1 cut(s) 114
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 2 cut(s) 113, 157
Tru9I TTAA 2 cut(s) 113, 157
TseI GCWGC 2 cut(s) 67, 92
TspGWI ACGGA 1 cut(s) 121
VpaK11BI GGWCC 1 cut(s) 129
XceI RCATGY 1 cut(s) 74
XspI CTAG 2 cut(s) 39, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.