Rorug03G0113600

phosphatidylinositol 4-phosphate 5-kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0007721
Physical Location & Seq
Forward (+)
9170330 .. 9170690
361 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0113600.1

Sequence Viewer

Length: 252 bp
ATGGCATCATCAACGCAGGACCTCAAGGACCCCCAGAAAAGGGCCGAGCTTGATGAGAGGGCAAGGAAGGGAGAGACTGTTATTCCTGGTGGAACTCGCGGGAAGACCCTCGAGGCTCAAGAGCACCTTGCTGAAGGAAGACGCAAGGGTGGACTAAGCACCACGGACAAGTCTGGAGAAGAACGTGCTCGCGAGGAAGGTATTCCGTTGAATCCGCTCGAGGATAAGGAAAAGCAAGAGGGACGTCGCTGA

Protein Analysis

83

Amino Acids

9.21

Weight (kDa)

6.61

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LEA_5 PF00477 12 - 51 7.9e-16 Small hydrophilic plant seed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 247
AbsI CCTCGAGG 1 cut(s) 110
AccBSI CCGCTC 1 cut(s) 217
AccII CGCG 2 cut(s) 99, 192
AciI CCGC 2 cut(s) 99, 215
AcuI CTGAAG 1 cut(s) 153
AcyI GRCGYC 1 cut(s) 244
AfiI CCNNNNNNNGG 2 cut(s) 39, 40
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
Alw21I GWGCWC 2 cut(s) 126, 190
Alw26I GTCTC 1 cut(s) 68
Ama87I CYCGRG 2 cut(s) 110, 218
AoxI GGCC 1 cut(s) 42
Asp700I GAANNNNTTC 1 cut(s) 201
AspS9I GGNCC 3 cut(s) 19, 28, 42
AvaI CYCGRG 2 cut(s) 110, 218
AvaII GGWCC 2 cut(s) 19, 28
BbsI GAAGAC 2 cut(s) 110, 145
Bbv12I GWGCWC 2 cut(s) 126, 190
BciT130I CCWGG 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 87
Bme18I GGWCC 2 cut(s) 19, 28
BmeT110I CYCGRG 2 cut(s) 110, 218
BmgT120I GGNCC 3 cut(s) 19, 28, 42
BmiI GGNNCC 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 14
BpiI GAAGAC 2 cut(s) 110, 145
BpmI CTGGAG 1 cut(s) 195
BpuEI CTTGAG 2 cut(s) 8, 102
BsaHI GRCGYC 1 cut(s) 244
BsaJI CCNNGG 1 cut(s) 162
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bsc4I CCNNNNNNNGG 2 cut(s) 39, 40
BseBI CCWGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 162
BseLI CCNNNNNNNGG 2 cut(s) 39, 40
Bsh1236I CGCG 2 cut(s) 99, 192
BshFI GGCC 1 cut(s) 44
BsiHKAI GWGCWC 2 cut(s) 126, 190
BsiHKCI CYCGRG 2 cut(s) 110, 218
BslI CCNNNNNNNGG 2 cut(s) 39, 40
BsmAI GTCTC 1 cut(s) 68
BsnI GGCC 1 cut(s) 44
BsoBI CYCGRG 2 cut(s) 110, 218
Bsp1286I GDGCHC 2 cut(s) 126, 190
Bsp68I TCGCGA 1 cut(s) 192
BspACI CCGC 2 cut(s) 99, 215
BspANI GGCC 1 cut(s) 44
BspFNI CGCG 2 cut(s) 99, 192
BspLI GGNNCC 1 cut(s) 30
BsrBI CCGCTC 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 162
BssNI GRCGYC 1 cut(s) 244
Bst2UI CCWGG 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 79
BstACI GRCGYC 1 cut(s) 244
BstC8I GCNNGC 1 cut(s) 190
BstDEI CTNAG 1 cut(s) 155
BstDSI CCRYGG 1 cut(s) 162
BstFNI CGCG 2 cut(s) 99, 192
BstMAI GTCTC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BstUI CGCG 2 cut(s) 99, 192
BstV2I GAAGAC 2 cut(s) 110, 145
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 162
BtuMI TCGCGA 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 190
Cfr13I GGNCC 3 cut(s) 19, 28, 42
CseI GACGC 1 cut(s) 150
CviJI RGCY 3 cut(s) 44, 49, 116
CviKI_1 RGCY 3 cut(s) 44, 49, 116
DdeI CTNAG 1 cut(s) 155
Eco47I GGWCC 2 cut(s) 19, 28
Eco57I CTGAAG 1 cut(s) 153
Eco88I CYCGRG 2 cut(s) 110, 218
EcoO109I RGGNCCY 2 cut(s) 19, 28
EcoRII CCWGG 1 cut(s) 85
FalI AAGNNNNNCTT 2 cut(s) 111, 143
FauI CCCGC 1 cut(s) 92
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 44
HgaI GACGC 1 cut(s) 150
Hin1I GRCGYC 1 cut(s) 244
HinfI GANTC 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 152
Hpy188III TCNNGA 3 cut(s) 119, 174, 191
Hpy8I GTNNAC 1 cut(s) 152
Hpy99I CGWCG 1 cut(s) 249
HpyAV CCTTC 3 cut(s) 61, 128, 191
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4IV ACGT 2 cut(s) 184, 244
HpyF3I CTNAG 1 cut(s) 155
HpySE526I ACGT 2 cut(s) 184, 244
Hsp92I GRCGYC 1 cut(s) 244
LpnPI CCDG 5 cut(s) 2, 47, 72, 99, 159
LweI GCATC 1 cut(s) 14
MaeII ACGT 2 cut(s) 184, 244
MbiI CCGCTC 1 cut(s) 217
MboII GAAGA 3 cut(s) 115, 150, 191
MhlI GDGCHC 2 cut(s) 126, 190
MnlI CCTC 7 cut(s) 32, 51, 106, 119, 187, 214, 232
MroXI GAANNNNTTC 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
MvnI CGCG 2 cut(s) 99, 192
NlaIV GGNNCC 1 cut(s) 30
NmeAIII GCCGAG 1 cut(s) 70
NruI TCGCGA 1 cut(s) 192
PaeR7I CTCGAG 2 cut(s) 110, 218
PdmI GAANNNNTTC 1 cut(s) 201
PfeI GAWTC 1 cut(s) 211
PpuMI RGGWCCY 2 cut(s) 19, 28
Psp5II RGGWCCY 2 cut(s) 19, 28
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 30
PspPI GGNCC 3 cut(s) 19, 28, 42
PspPPI RGGWCCY 2 cut(s) 19, 28
PspXI VCTCGAGB 2 cut(s) 110, 218
RruI TCGCGA 1 cut(s) 192
Sau96I GGNCC 3 cut(s) 19, 28, 42
ScrFI CCNGG 1 cut(s) 87
SduI GDGCHC 2 cut(s) 126, 190
SetI ASST 6 cut(s) 24, 51, 129, 187, 202, 247
SfaNI GCATC 1 cut(s) 14
Sfr274I CTCGAG 2 cut(s) 110, 218
SinI GGWCC 2 cut(s) 19, 28
SlaI CTCGAG 2 cut(s) 110, 218
SmlI CTYRAG 4 cut(s) 23, 110, 117, 218
SmoI CTYRAG 4 cut(s) 23, 110, 117, 218
SsiI CCGC 2 cut(s) 99, 215
StyD4I CCNGG 1 cut(s) 85
TaaI ACNGT 1 cut(s) 79
TaiI ACGT 2 cut(s) 187, 247
TaqI TCGA 2 cut(s) 111, 219
TfiI GAWTC 1 cut(s) 211
TspGWI ACGGA 2 cut(s) 179, 195
VpaK11BI GGWCC 2 cut(s) 19, 28
XhoI CTCGAG 2 cut(s) 110, 218
XmnI GAANNNNTTC 1 cut(s) 201
ZraI GACGTC 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.