Rorug03G0284600

Belongs to the small heat shock protein (HSP20) family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
28601032 .. 28601431
400 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0284600.1

Sequence Viewer

Length: 273 bp
ATGGAATCAAATTTGGAATTTAGTGGTTCTTGTAATGACAAAACAATGGCCTCCAAAGATGATGAATTCAGTGGATTTGATGCTTGTGTAAAACTTCCTACTTTAGCAAGAATGGCTCGAGACATATTAGCAGCTCCTTCTGAGGCAGCATTTAGTGTTGGAGGAAGAGTGATCGATGAATCTCGTGCTTCTATGCTTCCAGAAACTGTAAAGGCTTTGGTGACTACAAAAGATTGGCTTCCCTCTCGAAAATGGAAAAATAAGTCTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.86

Weight (kDa)

5.42

Isoelectric Point (pI)

50.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimer_Tnp_hAT PF05699 31 - 80 1.1e-10 hAT family C-terminal dimerisation region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012033)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 10, 17, 65
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Alw26I GTCTC 1 cut(s) 114
AlwNI CAGNNNCTG 1 cut(s) 206
Ama87I CYCGRG 1 cut(s) 117
AoxI GGCC 1 cut(s) 48
ApeKI GCWGC 2 cut(s) 131, 146
ApoI RAATTY 3 cut(s) 10, 17, 65
AsuHPI GGTGA 1 cut(s) 232
AvaI CYCGRG 1 cut(s) 117
BauI CACGAG 1 cut(s) 183
BbvI GCAGC 2 cut(s) 143, 158
BcoDI GTCTC 1 cut(s) 114
BisI GCNGC 2 cut(s) 132, 147
BlsI GCNGC 2 cut(s) 133, 148
BmeT110I CYCGRG 1 cut(s) 117
BmsI GCATC 1 cut(s) 70
Bsa29I ATCGAT 1 cut(s) 174
BsaXI ACNNNNNCTCC 2 cut(s) 153, 183
BseCI ATCGAT 1 cut(s) 174
BseMII CTCAG 1 cut(s) 132
BseXI GCAGC 2 cut(s) 143, 158
BshFI GGCC 1 cut(s) 50
BshVI ATCGAT 1 cut(s) 174
BsiHKCI CYCGRG 1 cut(s) 117
BsmAI GTCTC 1 cut(s) 114
BsnI GGCC 1 cut(s) 50
BsoBI CYCGRG 1 cut(s) 117
Bsp143I GATC 1 cut(s) 171
BspANI GGCC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 133
BspDI ATCGAT 1 cut(s) 174
BssMI GATC 1 cut(s) 171
BssSI CACGAG 1 cut(s) 183
Bst2BI CACGAG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 208
Bst6I CTCTTC 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 141
BstKTI GATC 1 cut(s) 174
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstV1I GCAGC 2 cut(s) 143, 158
Bsu15I ATCGAT 1 cut(s) 174
BsuRI GGCC 1 cut(s) 50
BsuTUI ATCGAT 1 cut(s) 174
BtsIMutI CAGTG 1 cut(s) 76
CaiI CAGNNNCTG 1 cut(s) 206
ClaI ATCGAT 1 cut(s) 174
CviJI RGCY 5 cut(s) 50, 116, 134, 215, 238
CviKI_1 RGCY 5 cut(s) 50, 116, 134, 215, 238
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eam1104I CTCTTC 1 cut(s) 160
EarI CTCTTC 1 cut(s) 160
Eco88I CYCGRG 1 cut(s) 117
EcoRI GAATTC 1 cut(s) 65
FaiI YATR 2 cut(s) 125, 194
FalI AAGNNNNNCTT 2 cut(s) 222, 254
Fnu4HI GCNGC 2 cut(s) 132, 147
Fsp4HI GCNGC 2 cut(s) 132, 147
GluI GCNGC 2 cut(s) 132, 147
HaeIII GGCC 1 cut(s) 50
HinfI GANTC 2 cut(s) 5, 179
HphI GGTGA 1 cut(s) 232
Hpy188I TCNGA 2 cut(s) 142, 268
Hpy188III TCNNGA 3 cut(s) 119, 200, 246
HpyAV CCTTC 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 141
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 1 cut(s) 213
Lsp1109I GCAGC 2 cut(s) 143, 158
LweI GCATC 1 cut(s) 70
MaeIII GTNAC 1 cut(s) 220
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 1 cut(s) 177
MluCI AATT 3 cut(s) 10, 17, 65
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 4 cut(s) 61, 136, 155, 253
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 171
NmuCI GTSAC 1 cut(s) 220
PaeR7I CTCGAG 1 cut(s) 117
PfeI GAWTC 2 cut(s) 5, 179
PkrI GCNGC 2 cut(s) 133, 148
PstNI CAGNNNCTG 1 cut(s) 206
SatI GCNGC 2 cut(s) 132, 147
Sau3AI GATC 1 cut(s) 171
SetI ASST 1 cut(s) 136
SfaNI GCATC 1 cut(s) 70
Sfr274I CTCGAG 1 cut(s) 117
SgeI CNNG 9 cut(s) 42, 96, 120, 129, 131, 195, 197, 212, 258
SlaI CTCGAG 1 cut(s) 117
SmlI CTYRAG 1 cut(s) 117
SmoI CTYRAG 1 cut(s) 117
Sse9I AATT 3 cut(s) 10, 17, 65
TaaI ACNGT 1 cut(s) 208
TaqI TCGA 3 cut(s) 118, 174, 247
TasI AATT 3 cut(s) 10, 17, 65
TfiI GAWTC 2 cut(s) 5, 179
TscAI CASTG 1 cut(s) 76
TseFI GTSAC 1 cut(s) 220
TseI GCWGC 2 cut(s) 131, 146
Tsp45I GTSAC 1 cut(s) 220
TspDTI ATGAA 2 cut(s) 78, 192
TspRI CASTG 1 cut(s) 76
XapI RAATTY 3 cut(s) 10, 17, 65
XhoI CTCGAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.