Rorug03G0302900

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
31985326 .. 31985835
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0302900.1

Sequence Viewer

Length: 183 bp
ATGAATTGGCTCAACTTGCCCATAACAAGATCAAAACTAATTCCGGCTGGTGTTTGTGCGGTAATTGGGCAGCTCTCCAACCCCCCTTCCACTAATGCACTAGTGGCTACTGCAACAACGCCTGGCTTTGAAAGGAATGCACCAATTCTCCTTTGTTTGCACCTGCAGTTGGGTCAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.35

Weight (kDa)

8.94

Isoelectric Point (pI)

42.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 171
Acc36I ACCTGC 1 cut(s) 171
AciI CCGC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 169
AgsI TTSAA 1 cut(s) 131
AhlI ACTAGT 1 cut(s) 100
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
ApeKI GCWGC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 123
BcuI ACTAGT 1 cut(s) 100
BfaI CTAG 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 164
BfuAI ACCTGC 1 cut(s) 171
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BsaXI ACNNNNNCTCC 2 cut(s) 132, 162
Bsc4I CCNNNNNNNGG 1 cut(s) 169
BseBI CCWGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 169
BseXI GCAGC 1 cut(s) 82
BsiSI CCGG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 169
BsmI GAATGC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 29
BspACI CCGC 1 cut(s) 59
BspMAI CTGCAG 1 cut(s) 168
BspMI ACCTGC 1 cut(s) 171
BssMI GATC 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 123
BstKTI GATC 1 cut(s) 32
BstMBI GATC 1 cut(s) 29
BstMWI GCNNNNNNNGC 2 cut(s) 16, 104
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 82
BveI ACCTGC 1 cut(s) 171
CviJI RGCY 5 cut(s) 10, 47, 73, 107, 126
CviKI_1 RGCY 5 cut(s) 10, 47, 73, 107, 126
DpnI GATC 1 cut(s) 31
DpnII GATC 1 cut(s) 29
EcoRII CCWGG 1 cut(s) 121
FaiI YATR 1 cut(s) 23
Fnu4HI GCNGC 1 cut(s) 71
Fsp4HI GCNGC 1 cut(s) 71
FspBI CTAG 1 cut(s) 101
GluI GCNGC 1 cut(s) 71
HapII CCGG 1 cut(s) 44
HpaII CCGG 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 177
HpyAV CCTTC 1 cut(s) 96
HpyCH4V TGCA 5 cut(s) 98, 113, 140, 160, 166
HpyF10VI GCNNNNNNNGC 2 cut(s) 16, 104
Kzo9I GATC 1 cut(s) 29
LpnPI CCDG 5 cut(s) 33, 57, 108, 135, 176
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 1 cut(s) 101
MalI GATC 1 cut(s) 31
MboI GATC 1 cut(s) 29
MluCI AATT 5 cut(s) 4, 39, 63, 144, 178
MmeI TCCRAC 1 cut(s) 102
MseI TTAA 1 cut(s) 181
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 123
Mva1269I GAATGC 1 cut(s) 142
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 2 cut(s) 16, 104
NdeII GATC 1 cut(s) 29
PaqCI CACCTGC 1 cut(s) 171
PctI GAATGC 1 cut(s) 142
PkrI GCNGC 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PstI CTGCAG 1 cut(s) 168
SaqAI TTAA 1 cut(s) 181
SatI GCNGC 1 cut(s) 71
Sau3AI GATC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 123
SetI ASST 2 cut(s) 75, 165
SfcI CTRYAG 1 cut(s) 164
SgeI CNNG 8 cut(s) 28, 39, 56, 60, 113, 134, 135, 175
SpeI ACTAGT 1 cut(s) 100
Sse9I AATT 5 cut(s) 4, 39, 63, 144, 178
SsiI CCGC 1 cut(s) 59
SspMI CTAG 1 cut(s) 101
StyD4I CCNGG 1 cut(s) 121
TasI AATT 5 cut(s) 4, 39, 63, 144, 178
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TseI GCWGC 1 cut(s) 70
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.