Rorug03G0323700

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
35417438 .. 35418598
1161 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0323700.1

Sequence Viewer

Length: 225 bp
ATGGTCCGCAACAAGGCCAGTGCTGCCCTCTACTGGATTCTCTTAATATTTCTAGTGCTACTCTTCTCTTCCGACATAGCATTTGCCAGAGTTTCACCATTTTCAAAAAACAAAGAGAACACCAGGCTGCACTGGCAAATGAAAGCAGATGTAGGGAGTCCTCATGATCCTGGCTCAGGGCAGCACCCTAAGAACACACCTCCACCACCTGACGACGTTGCTTGA

Protein Analysis

74

Amino Acids

8.23

Weight (kDa)

9.3

Isoelectric Point (pI)

37.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011197)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 7
AclWI GGATC 1 cut(s) 161
AfiI CCNNNNNNNGG 3 cut(s) 13, 33, 176
AgsI TTSAA 1 cut(s) 105
AjnI CCWGG 2 cut(s) 122, 169
AlwI GGATC 1 cut(s) 161
AoxI GGCC 1 cut(s) 15
ApeKI GCWGC 3 cut(s) 23, 127, 181
ArsI GACNNNNNNTTYG 2 cut(s) 65, 97
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 87
AvaII GGWCC 1 cut(s) 4
BbvI GCAGC 3 cut(s) 10, 114, 193
BciT130I CCWGG 2 cut(s) 124, 171
BfaI CTAG 1 cut(s) 53
BisI GCNGC 3 cut(s) 24, 128, 182
BlsI GCNGC 3 cut(s) 25, 129, 183
Bme1390I CCNGG 2 cut(s) 124, 171
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 2 cut(s) 124, 171
Bpu10I CCTNAGC 1 cut(s) 175
Bsc4I CCNNNNNNNGG 3 cut(s) 13, 33, 176
Bse1I ACTGG 3 cut(s) 18, 38, 137
BseBI CCWGG 2 cut(s) 124, 171
BseLI CCNNNNNNNGG 3 cut(s) 13, 33, 176
BseMII CTCAG 1 cut(s) 189
BseNI ACTGG 3 cut(s) 18, 38, 137
BseXI GCAGC 3 cut(s) 10, 114, 193
BsgI GTGCAG 1 cut(s) 113
BshFI GGCC 1 cut(s) 17
BslI CCNNNNNNNGG 3 cut(s) 13, 33, 176
BsnI GGCC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 166
BspACI CCGC 1 cut(s) 7
BspANI GGCC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 188
BspHI TCATGA 1 cut(s) 163
BspPI GGATC 1 cut(s) 161
BsrI ACTGG 3 cut(s) 18, 38, 137
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 2 cut(s) 124, 171
Bst6I CTCTTC 2 cut(s) 68, 73
BstDEI CTNAG 2 cut(s) 175, 189
BstENI CCTNNNNNAGG 1 cut(s) 174
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 2 cut(s) 23, 133
BstNI CCWGG 2 cut(s) 124, 171
BstSCI CCNGG 2 cut(s) 122, 169
BstV1I GCAGC 3 cut(s) 10, 114, 193
BsuRI GGCC 1 cut(s) 17
BtsIMutI CAGTG 2 cut(s) 25, 130
CciI TCATGA 1 cut(s) 163
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 164
CviJI RGCY 3 cut(s) 17, 127, 174
CviKI_1 RGCY 3 cut(s) 17, 127, 174
DdeI CTNAG 2 cut(s) 175, 189
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eam1104I CTCTTC 2 cut(s) 68, 73
EarI CTCTTC 2 cut(s) 68, 73
Eco47I GGWCC 1 cut(s) 4
EcoNI CCTNNNNNAGG 1 cut(s) 174
EcoRII CCWGG 2 cut(s) 122, 169
FaeI CATG 1 cut(s) 167
FaiI YATR 2 cut(s) 77, 165
FatI CATG 1 cut(s) 163
Fnu4HI GCNGC 3 cut(s) 24, 128, 182
Fsp4HI GCNGC 3 cut(s) 24, 128, 182
FspBI CTAG 1 cut(s) 53
GluI GCNGC 3 cut(s) 24, 128, 182
HaeIII GGCC 1 cut(s) 17
Hin1II CATG 1 cut(s) 167
HinfI GANTC 2 cut(s) 37, 157
HphI GGTGA 1 cut(s) 87
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 164
Hpy99I CGWCG 1 cut(s) 218
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 130
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 133
HpyF3I CTNAG 2 cut(s) 175, 189
HpySE526I ACGT 1 cut(s) 216
Hsp92II CATG 1 cut(s) 167
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 9 cut(s) 19, 31, 100, 109, 118, 136, 156, 162, 183
Lsp1109I GCAGC 3 cut(s) 10, 114, 193
MaeI CTAG 1 cut(s) 53
MaeII ACGT 1 cut(s) 216
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 2 cut(s) 55, 60
MlyI GAGTC 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 3 cut(s) 38, 171, 210
MseI TTAA 1 cut(s) 44
MspR9I CCNGG 2 cut(s) 124, 171
MvaI CCWGG 2 cut(s) 124, 171
MwoI GCNNNNNNNGC 2 cut(s) 23, 133
NdeII GATC 1 cut(s) 166
NlaIII CATG 1 cut(s) 167
PagI TCATGA 1 cut(s) 163
PfeI GAWTC 1 cut(s) 37
PkrI GCNGC 3 cut(s) 25, 129, 183
PleI GAGTC 1 cut(s) 165
PpsI GAGTC 1 cut(s) 165
Psp6I CCWGG 2 cut(s) 122, 169
PspGI CCWGG 2 cut(s) 122, 169
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 44
SatI GCNGC 3 cut(s) 24, 128, 182
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 166
ScrFI CCNGG 2 cut(s) 124, 171
SetI ASST 3 cut(s) 202, 211, 219
SinI GGWCC 1 cut(s) 4
SsiI CCGC 1 cut(s) 7
SspI AATATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 2 cut(s) 122, 169
TaiI ACGT 1 cut(s) 219
TfiI GAWTC 1 cut(s) 37
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
TscAI CASTG 2 cut(s) 25, 137
TseI GCWGC 3 cut(s) 23, 127, 181
TspDTI ATGAA 1 cut(s) 155
TspRI CASTG 2 cut(s) 25, 137
VpaK11BI GGWCC 1 cut(s) 4
XagI CCTNNNNNAGG 1 cut(s) 174
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.