Rorug03G0372200

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
45622510 .. 45623276
767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0372200.1

Sequence Viewer

Length: 369 bp
ATGCGCCCTTATCCCTATTGCGCGCCACCATTCCCCTCTAAGAAACGTCGAACCCAATTCGAGCCGAATCCAAATCCTACAGTTCTCATCCTCGACGACGACCCGACCCCGCAGAAACCCGGCCCCAAATCCACGGCCTACTTGGTCCCGGACACCCCGAATTCCGATATTGCAATCGTGAAATGCACAAGGGCTTCCCAGCACAAGTTATCTGGCATCAATGGATTGATATGTTTGGAATCCGATAATGAGCCCGGAAGTAGTTGTGGAGGGGAAAAGAAGAAGGGAAATGGATCAATGCTGGGTGGTTTTGGTCTGGCCAAGGACCATATAGAGGAAGATGAGAAATCAATTGTTATGCGAAGCTGA

Protein Analysis

122

Amino Acids

13.21

Weight (kDa)

7.65

Isoelectric Point (pI)

53.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 23
AciI CCGC 1 cut(s) 110
AclWI GGATC 1 cut(s) 301
AcoI YGGCCR 1 cut(s) 318
AcsI RAATTY 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 334
AluBI AGCT 1 cut(s) 366
AluI AGCT 1 cut(s) 366
AlwI GGATC 1 cut(s) 301
AoxI GGCC 3 cut(s) 121, 135, 318
ApoI RAATTY 1 cut(s) 160
AspLEI GCGC 3 cut(s) 6, 23, 25
AspS9I GGNCC 3 cut(s) 122, 145, 325
AsuC2I CCSGG 3 cut(s) 120, 149, 255
AvaII GGWCC 2 cut(s) 145, 325
BalI TGGCCA 1 cut(s) 320
BanII GRGCYC 1 cut(s) 255
BceAI ACGGC 1 cut(s) 150
BcnI CCSGG 3 cut(s) 120, 149, 255
BfmI CTRYAG 1 cut(s) 78
Bme1390I CCNGG 3 cut(s) 120, 149, 255
Bme18I GGWCC 2 cut(s) 145, 325
BmgT120I GGNCC 3 cut(s) 122, 145, 325
BmiI GGNNCC 2 cut(s) 124, 147
BmrFI CCNGG 3 cut(s) 120, 149, 255
BmsI GCATC 1 cut(s) 225
BpuMI CCSGG 3 cut(s) 120, 149, 255
BsaJI CCNNGG 2 cut(s) 132, 321
Bsc4I CCNNNNNNNGG 1 cut(s) 334
BseDI CCNNGG 2 cut(s) 132, 321
BseGI GGATG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 334
BsePI GCGCGC 1 cut(s) 21
BseYI CCCAGC 2 cut(s) 198, 301
Bsh1236I CGCG 1 cut(s) 23
BshFI GGCC 3 cut(s) 123, 137, 320
BsiSI CCGG 3 cut(s) 120, 149, 255
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 334
BsmFI GGGAC 1 cut(s) 131
BsnI GGCC 3 cut(s) 123, 137, 320
Bsp1286I GDGCHC 1 cut(s) 255
Bsp143I GATC 1 cut(s) 293
BspACI CCGC 1 cut(s) 110
BspANI GGCC 3 cut(s) 123, 137, 320
BspFNI CGCG 1 cut(s) 23
BspLI GGNNCC 2 cut(s) 124, 147
BspPI GGATC 1 cut(s) 301
BssECI CCNNGG 2 cut(s) 132, 321
BssHII GCGCGC 1 cut(s) 21
BssMI GATC 1 cut(s) 293
BssT1I CCWWGG 1 cut(s) 321
Bst4CI ACNGT 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 39
BstDSI CCRYGG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 87
BstFNI CGCG 1 cut(s) 23
BstHHI GCGC 3 cut(s) 6, 23, 25
BstKTI GATC 1 cut(s) 296
BstMBI GATC 1 cut(s) 293
BstSCI CCNGG 3 cut(s) 118, 147, 253
BstSFI CTRYAG 1 cut(s) 78
BstUI CGCG 1 cut(s) 23
BsuRI GGCC 3 cut(s) 123, 137, 320
BtgI CCRYGG 1 cut(s) 132
BtsCI GGATG 1 cut(s) 87
Cac8I GCNNGC 1 cut(s) 23
CfoI GCGC 3 cut(s) 6, 23, 25
Cfr13I GGNCC 3 cut(s) 122, 145, 325
CviJI RGCY 7 cut(s) 64, 123, 137, 194, 253, 320, 366
CviKI_1 RGCY 7 cut(s) 64, 123, 137, 194, 253, 320, 366
DdeI CTNAG 1 cut(s) 39
DpnI GATC 1 cut(s) 295
DpnII GATC 1 cut(s) 293
EaeI YGGCCR 1 cut(s) 318
Eco130I CCWWGG 1 cut(s) 321
Eco24I GRGCYC 1 cut(s) 255
Eco47I GGWCC 2 cut(s) 145, 325
EcoRI GAATTC 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 321
EcoT38I GRGCYC 1 cut(s) 255
ErhI CCWWGG 1 cut(s) 321
FaiI YATR 4 cut(s) 232, 330, 332, 359
FaqI GGGAC 1 cut(s) 131
FauI CCCGC 1 cut(s) 117
FokI GGATG 1 cut(s) 74
FriOI GRGCYC 1 cut(s) 255
GlaI GCGC 3 cut(s) 5, 22, 24
GsaI CCCAGC 2 cut(s) 202, 305
HaeIII GGCC 3 cut(s) 123, 137, 320
HapII CCGG 3 cut(s) 120, 149, 255
HhaI GCGC 3 cut(s) 6, 23, 25
Hin6I GCGC 3 cut(s) 4, 21, 23
HinP1I GCGC 3 cut(s) 4, 21, 23
HinfI GANTC 2 cut(s) 67, 239
HpaII CCGG 3 cut(s) 120, 149, 255
Hpy188I TCNGA 2 cut(s) 166, 244
Hpy188III TCNNGA 1 cut(s) 178
Hpy99I CGWCG 3 cut(s) 51, 98, 101
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 173, 186
HpyF3I CTNAG 1 cut(s) 39
HpySE526I ACGT 1 cut(s) 46
HspAI GCGC 3 cut(s) 4, 21, 23
Kzo9I GATC 1 cut(s) 293
LpnPI CCDG 7 cut(s) 133, 162, 198, 212, 268, 287, 302
LweI GCATC 1 cut(s) 225
MaeII ACGT 1 cut(s) 46
MalI GATC 1 cut(s) 295
MboI GATC 1 cut(s) 293
MboII GAAGA 2 cut(s) 292, 350
MfeI CAATTG 1 cut(s) 351
MhlI GDGCHC 1 cut(s) 255
MlsI TGGCCA 1 cut(s) 320
MluCI AATT 3 cut(s) 56, 160, 351
MluNI TGGCCA 1 cut(s) 320
MnlI CCTC 4 cut(s) 46, 101, 263, 328
Mox20I TGGCCA 1 cut(s) 320
MscI TGGCCA 1 cut(s) 320
Msp20I TGGCCA 1 cut(s) 320
MspI CCGG 3 cut(s) 120, 149, 255
MspR9I CCNGG 3 cut(s) 120, 149, 255
MunI CAATTG 1 cut(s) 351
MvnI CGCG 1 cut(s) 23
NciI CCSGG 3 cut(s) 120, 149, 255
NdeII GATC 1 cut(s) 293
NlaIV GGNNCC 2 cut(s) 124, 147
PauI GCGCGC 1 cut(s) 21
PfeI GAWTC 2 cut(s) 67, 239
PfoI TCCNGGA 1 cut(s) 147
PspFI CCCAGC 2 cut(s) 198, 301
PspN4I GGNNCC 2 cut(s) 124, 147
PspPI GGNCC 3 cut(s) 122, 145, 325
PteI GCGCGC 1 cut(s) 21
Sau3AI GATC 1 cut(s) 293
Sau96I GGNCC 3 cut(s) 122, 145, 325
ScrFI CCNGG 3 cut(s) 120, 149, 255
SduI GDGCHC 1 cut(s) 255
SetI ASST 2 cut(s) 49, 368
SfaNI GCATC 1 cut(s) 225
SfcI CTRYAG 1 cut(s) 78
SinI GGWCC 2 cut(s) 145, 325
Sse9I AATT 3 cut(s) 56, 160, 351
SsiI CCGC 1 cut(s) 110
StyD4I CCNGG 3 cut(s) 118, 147, 253
StyI CCWWGG 1 cut(s) 321
TaaI ACNGT 1 cut(s) 82
TaiI ACGT 1 cut(s) 49
TaqI TCGA 3 cut(s) 49, 60, 93
TasI AATT 3 cut(s) 56, 160, 351
TfiI GAWTC 2 cut(s) 67, 239
VpaK11BI GGWCC 2 cut(s) 145, 325
XapI RAATTY 1 cut(s) 160
XcmI CCANNNNNNNNNTGG 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.