Rorug05G0294900

Belongs to the NPH3 family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
34000458 .. 34001174
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0294900.1

Sequence Viewer

Length: 309 bp
ATGTCATTTGCTTATGGATTTCAAGATAGAGTCAGTGGGAGCTTCTATGTTAAAAGTAAATTGGTTGAAGCTAAGCTAAGCTCTTTTCAGTTTATATCTGATTCGGAGAACTATGCACTTCTCTTAGATTATGTTGGCCTTTTCATATTGAGAACTTGCTCTTTAGTTGGTTACGCGGTTAATGACATGCTTGATTTGATTGTGTCCTTATATGTTCCATCTAACATTGGTTATTACAGCCACAGTCTGCTGTTGGATGATTCTAGAGAAAAGGATCTTATTCCAGAACCACCGTTTATGCTTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.57

Weight (kDa)

4.51

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 176
AciI CCGC 1 cut(s) 176
AclWI GGATC 1 cut(s) 282
AgsI TTSAA 2 cut(s) 23, 68
AluBI AGCT 4 cut(s) 42, 71, 76, 81
AluI AGCT 4 cut(s) 42, 71, 76, 81
AlwI GGATC 1 cut(s) 282
AoxI GGCC 1 cut(s) 136
BccI CCATC 1 cut(s) 226
BfaI CTAG 1 cut(s) 264
BlpI GCTNAGC 2 cut(s) 72, 77
Bpu1102I GCTNAGC 2 cut(s) 72, 77
BseGI GGATG 1 cut(s) 262
Bsh1236I CGCG 1 cut(s) 176
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 274
Bsp1720I GCTNAGC 2 cut(s) 72, 77
BspACI CCGC 1 cut(s) 176
BspANI GGCC 1 cut(s) 138
BspFNI CGCG 1 cut(s) 176
BspPI GGATC 1 cut(s) 282
BssMI GATC 1 cut(s) 274
Bst4CI ACNGT 2 cut(s) 245, 294
BstDEI CTNAG 3 cut(s) 72, 77, 124
BstF5I GGATG 1 cut(s) 262
BstFNI CGCG 1 cut(s) 176
BstKTI GATC 1 cut(s) 277
BstMBI GATC 1 cut(s) 274
BstNSI RCATGY 1 cut(s) 190
BstUI CGCG 1 cut(s) 176
BstX2I RGATCY 1 cut(s) 274
BstYI RGATCY 1 cut(s) 274
BsuRI GGCC 1 cut(s) 138
BtsCI GGATG 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 40
CviAII CATG 1 cut(s) 187
CviJI RGCY 6 cut(s) 42, 71, 76, 81, 138, 240
CviKI_1 RGCY 6 cut(s) 42, 71, 76, 81, 138, 240
DdeI CTNAG 3 cut(s) 72, 77, 124
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
FaeI CATG 1 cut(s) 190
FatI CATG 1 cut(s) 186
FokI GGATG 1 cut(s) 269
FspBI CTAG 1 cut(s) 264
HaeIII GGCC 1 cut(s) 138
Hin1II CATG 1 cut(s) 190
HinfI GANTC 3 cut(s) 30, 101, 260
Hpy188I TCNGA 2 cut(s) 100, 106
Hpy188III TCNNGA 3 cut(s) 23, 264, 284
HpyCH4III ACNGT 2 cut(s) 245, 294
HpyCH4V TGCA 1 cut(s) 116
HpyF3I CTNAG 3 cut(s) 72, 77, 124
Hsp92II CATG 1 cut(s) 190
Kzo9I GATC 1 cut(s) 274
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 1 cut(s) 297
MaeI CTAG 1 cut(s) 264
MaeIII GTNAC 1 cut(s) 170
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MflI RGATCY 1 cut(s) 274
MluCI AATT 2 cut(s) 59, 304
MlyI GAGTC 1 cut(s) 39
MmeI TCCRAC 1 cut(s) 234
MseI TTAA 3 cut(s) 51, 180, 303
MvnI CGCG 1 cut(s) 176
NdeII GATC 1 cut(s) 274
NlaIII CATG 1 cut(s) 190
NspI RCATGY 1 cut(s) 190
PfeI GAWTC 2 cut(s) 101, 260
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
PsuI RGATCY 1 cut(s) 274
SaqAI TTAA 3 cut(s) 51, 180, 303
Sau3AI GATC 1 cut(s) 274
SchI GAGTC 1 cut(s) 39
SetI ASST 4 cut(s) 44, 73, 78, 83
SgeI CNNG 7 cut(s) 35, 168, 187, 199, 203, 276, 296
Sse9I AATT 2 cut(s) 59, 304
SsiI CCGC 1 cut(s) 176
SspMI CTAG 1 cut(s) 264
TaaI ACNGT 2 cut(s) 245, 294
TasI AATT 2 cut(s) 59, 304
TfiI GAWTC 2 cut(s) 101, 260
Tru1I TTAA 3 cut(s) 51, 180, 303
Tru9I TTAA 3 cut(s) 51, 180, 303
TscAI CASTG 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 133
TspRI CASTG 1 cut(s) 40
XbaI TCTAGA 1 cut(s) 263
XceI RCATGY 1 cut(s) 190
XspI CTAG 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.