Rorug06G0285000

AarF domain-containing protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
43330702 .. 43331280
579 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0285000.1

Sequence Viewer

Length: 393 bp
ATGAACCCTTCCCCAATTCTAGTGCAGGATGCTGGGGATGAAAAACCCTGCACCAGTGGCCATGGAGTTGTGGTTGCTGCTGCTGCTGCTGTGGCTCCTGAGTGGTGCTCAAAGAAAATAACAGGCTTGATCAAGGACATTACATTATGTGATCCGGACAAGCTTGATGTTGGGATTCCATCTGGATCACAAAAAAGTGGTTATGAAAGAGTATGCACACAGGGAGTTGTGGTTGCTGCTGCTACTAAGGAGCCTCCAAAATGTTGCTCAGGCTTGATCAAGGTCATTACAACTGATTCTCAAAAGTGCGATGCGGTGAATTCTTCTGGATCAAGAAAATCTGGCGGTGAAAGAGCACGCACCAGTGTACACCAGTGTAATGGAAGGGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

13.35

Weight (kDa)

8.44

Isoelectric Point (pI)

26.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 154
AciI CCGC 2 cut(s) 314, 345
AclWI GGATC 3 cut(s) 146, 193, 337
AcoI YGGCCR 1 cut(s) 58
AcsI RAATTY 1 cut(s) 319
AfaI GTAC 1 cut(s) 369
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
Alw21I GWGCWC 2 cut(s) 110, 358
AlwI GGATC 3 cut(s) 146, 193, 337
Aor13HI TCCGGA 1 cut(s) 154
AoxI GGCC 1 cut(s) 58
ApeKI GCWGC 6 cut(s) 77, 80, 83, 86, 236, 239
ApoI RAATTY 1 cut(s) 319
AsuHPI GGTGA 2 cut(s) 328, 359
BalI TGGCCA 1 cut(s) 60
Bbv12I GWGCWC 2 cut(s) 110, 358
BbvI GCAGC 6 cut(s) 64, 67, 70, 73, 223, 226
BccI CCATC 1 cut(s) 187
BclI TGATCA 2 cut(s) 129, 276
BfaI CTAG 1 cut(s) 20
BisI GCNGC 6 cut(s) 78, 81, 84, 87, 237, 240
BlsI GCNGC 6 cut(s) 79, 82, 85, 88, 238, 241
BmiI GGNNCC 2 cut(s) 96, 252
BmsI GCATC 2 cut(s) 19, 301
BplI GAGNNNNNCTC 2 cut(s) 92, 124
Bpu10I CCTNAGC 1 cut(s) 268
BsaJI CCNNGG 1 cut(s) 61
BsaWI WCCGGW 1 cut(s) 154
BsaXI ACNNNNNCTCC 4 cut(s) 57, 87, 216, 246
Bse1I ACTGG 3 cut(s) 54, 363, 373
BseAI TCCGGA 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 2 cut(s) 34, 43
BseMII CTCAG 2 cut(s) 90, 282
BseNI ACTGG 3 cut(s) 54, 363, 373
BseXI GCAGC 6 cut(s) 64, 67, 70, 73, 223, 226
BseYI CCCAGC 1 cut(s) 32
BsgI GTGCAG 2 cut(s) 34, 44
BshFI GGCC 1 cut(s) 60
BsiHKAI GWGCWC 2 cut(s) 110, 358
BsiSI CCGG 1 cut(s) 155
BsnI GGCC 1 cut(s) 60
Bsp1286I GDGCHC 2 cut(s) 110, 358
Bsp13I TCCGGA 1 cut(s) 154
Bsp1407I TGTACA 1 cut(s) 367
Bsp143I GATC 5 cut(s) 129, 151, 185, 276, 329
Bsp19I CCATGG 1 cut(s) 61
BspACI CCGC 2 cut(s) 314, 345
BspANI GGCC 1 cut(s) 60
BspCNI CTCAG 2 cut(s) 91, 281
BspEI TCCGGA 1 cut(s) 154
BspLI GGNNCC 2 cut(s) 96, 252
BspPI GGATC 3 cut(s) 146, 193, 337
BsrGI TGTACA 1 cut(s) 367
BsrI ACTGG 3 cut(s) 54, 363, 373
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 5 cut(s) 129, 151, 185, 276, 329
BssT1I CCWWGG 1 cut(s) 61
BstAUI TGTACA 1 cut(s) 367
BstC8I GCNNGC 1 cut(s) 358
BstDEI CTNAG 3 cut(s) 99, 246, 268
BstDSI CCRYGG 1 cut(s) 61
BstF5I GGATG 2 cut(s) 34, 43
BstKTI GATC 5 cut(s) 132, 154, 188, 279, 332
BstMBI GATC 5 cut(s) 129, 151, 185, 276, 329
BstMWI GCNNNNNNNGC 4 cut(s) 57, 83, 86, 92
BstV1I GCAGC 6 cut(s) 64, 67, 70, 73, 223, 226
BstXI CCANNNNNNTGG 1 cut(s) 380
BsuRI GGCC 1 cut(s) 60
BtgI CCRYGG 1 cut(s) 61
BtgZI GCGATG 1 cut(s) 324
BtsCI GGATG 2 cut(s) 34, 43
BtsIMutI CAGTG 3 cut(s) 61, 370, 380
Cac8I GCNNGC 1 cut(s) 358
Csp6I GTAC 1 cut(s) 368
CviAII CATG 1 cut(s) 62
CviJI RGCY 7 cut(s) 60, 95, 126, 163, 253, 273, 390
CviKI_1 RGCY 7 cut(s) 60, 95, 126, 163, 253, 273, 390
CviQI GTAC 1 cut(s) 368
DdeI CTNAG 3 cut(s) 99, 246, 268
DpnI GATC 5 cut(s) 131, 153, 187, 278, 331
DpnII GATC 5 cut(s) 129, 151, 185, 276, 329
EaeI YGGCCR 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 61
EcoRI GAATTC 1 cut(s) 319
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 1 cut(s) 65
FaiI YATR 4 cut(s) 63, 148, 204, 214
FatI CATG 1 cut(s) 61
FbaI TGATCA 2 cut(s) 129, 276
Fnu4HI GCNGC 6 cut(s) 78, 81, 84, 87, 237, 240
FokI GGATG 2 cut(s) 41, 50
Fsp4HI GCNGC 6 cut(s) 78, 81, 84, 87, 237, 240
FspBI CTAG 1 cut(s) 20
GluI GCNGC 6 cut(s) 78, 81, 84, 87, 237, 240
GsaI CCCAGC 1 cut(s) 36
HaeIII GGCC 1 cut(s) 60
HapII CCGG 1 cut(s) 155
Hin1II CATG 1 cut(s) 65
HindIII AAGCTT 1 cut(s) 161
HinfI GANTC 2 cut(s) 175, 296
HpaII CCGG 1 cut(s) 155
HphI GGTGA 2 cut(s) 328, 359
Hpy166II GTNNAC 2 cut(s) 368, 370
Hpy188III TCNNGA 5 cut(s) 98, 155, 183, 327, 333
Hpy8I GTNNAC 2 cut(s) 368, 370
HpyAV CCTTC 2 cut(s) 18, 378
HpyCH4V TGCA 3 cut(s) 25, 51, 216
HpyF10VI GCNNNNNNNGC 4 cut(s) 57, 83, 86, 92
HpyF3I CTNAG 3 cut(s) 99, 246, 268
Hsp92II CATG 1 cut(s) 65
Kpn2I TCCGGA 1 cut(s) 154
Ksp22I TGATCA 2 cut(s) 129, 276
Kzo9I GATC 5 cut(s) 129, 151, 185, 276, 329
LmnI GCTCC 2 cut(s) 100, 250
Lsp1109I GCAGC 6 cut(s) 64, 67, 70, 73, 223, 226
LweI GCATC 2 cut(s) 19, 301
MaeI CTAG 1 cut(s) 20
MalI GATC 5 cut(s) 131, 153, 187, 278, 331
MboI GATC 5 cut(s) 129, 151, 185, 276, 329
MboII GAAGA 1 cut(s) 315
MhlI GDGCHC 2 cut(s) 110, 358
MlsI TGGCCA 1 cut(s) 60
MluCI AATT 2 cut(s) 15, 319
MluNI TGGCCA 1 cut(s) 60
MnlI CCTC 1 cut(s) 264
Mox20I TGGCCA 1 cut(s) 60
MroI TCCGGA 1 cut(s) 154
MscI TGGCCA 1 cut(s) 60
Msp20I TGGCCA 1 cut(s) 60
MspI CCGG 1 cut(s) 155
MwoI GCNNNNNNNGC 4 cut(s) 57, 83, 86, 92
NcoI CCATGG 1 cut(s) 61
NdeII GATC 5 cut(s) 129, 151, 185, 276, 329
NlaIII CATG 1 cut(s) 65
NlaIV GGNNCC 2 cut(s) 96, 252
PfeI GAWTC 2 cut(s) 175, 296
PkrI GCNGC 6 cut(s) 79, 82, 85, 88, 238, 241
PspFI CCCAGC 1 cut(s) 32
PspN4I GGNNCC 2 cut(s) 96, 252
RsaI GTAC 1 cut(s) 369
RsaNI GTAC 1 cut(s) 368
SatI GCNGC 6 cut(s) 78, 81, 84, 87, 237, 240
Sau3AI GATC 5 cut(s) 129, 151, 185, 276, 329
SduI GDGCHC 2 cut(s) 110, 358
SetI ASST 2 cut(s) 165, 285
SfaNI GCATC 2 cut(s) 19, 301
Sse9I AATT 2 cut(s) 15, 319
SsiI CCGC 2 cut(s) 314, 345
SspMI CTAG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 61
TasI AATT 2 cut(s) 15, 319
TatI WGTACW 1 cut(s) 367
TfiI GAWTC 2 cut(s) 175, 296
TscAI CASTG 3 cut(s) 61, 370, 380
TseI GCWGC 6 cut(s) 77, 80, 83, 86, 236, 239
TspDTI ATGAA 3 cut(s) 17, 54, 219
TspRI CASTG 3 cut(s) 61, 370, 380
XapI RAATTY 1 cut(s) 319
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.