Rh1CG082500
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
17197297 .. 17198287
991 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG082500.1

Sequence Viewer

Length: 306 bp
ATGGCAGCACGTCTTCACTCCACTCATGCTCTAGGAACCTTTGGTTATCATGCCCCAGAATATGCGATGACTGGACAGATTTGTTACGCTACACCAAAACTTAGTGAAGACAAAGTTAGGCAGTGCATTGATGCAAGACTAGGAGGAGAATTCCTCACCAAGGCTGTTGCAAAGATGGCTGCAGTTGCTGCCTTGTGTGTGCAACATGAGGCTGATTTCCGCCCAAACATGAGCATTGTGGTCAAAGCCCTACAACCACTGCTAAATGCTCGGCCTGGACCCACTGGTGAATCGCCAAGCTTGTGA

Protein Analysis

101

Amino Acids

10.81

Weight (kDa)

8.54

Isoelectric Point (pI)

42.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018732)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G62220
pyrus_communis pycom13g12270 pycom16g12110
rosa_chinensis RchiOBHm_Chr3g0487491
rosa_laevigata RLG00000003754 RLG00000023002
rosa_multiflora Rmu_co8428993.1_g000001 Rmu_sc0009883.1_g000004
rosa_samantha Rh1CG082500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 220
AcsI RAATTY 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 160
AjiI CACGTC 1 cut(s) 11
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 1 cut(s) 300
AluI AGCT 1 cut(s) 300
AlwNI CAGNNNCTG 1 cut(s) 188
AoxI GGCC 1 cut(s) 272
ApeKI GCWGC 3 cut(s) 5, 179, 188
ApoI RAATTY 1 cut(s) 149
AspS9I GGNCC 1 cut(s) 278
AsuHPI GGTGA 2 cut(s) 148, 299
AvaII GGWCC 1 cut(s) 278
BbsI GAAGAC 2 cut(s) 5, 114
BbvI GCAGC 3 cut(s) 17, 166, 175
BccI CCATC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 276
BfaI CTAG 2 cut(s) 32, 140
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 3 cut(s) 6, 180, 189
BlsI GCNGC 3 cut(s) 7, 181, 190
Bme1390I CCNGG 1 cut(s) 276
Bme18I GGWCC 1 cut(s) 278
BmgBI CACGTC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 278
BmiI GGNNCC 2 cut(s) 37, 280
BmrFI CCNGG 1 cut(s) 276
BmsI GCATC 1 cut(s) 121
BpiI GAAGAC 2 cut(s) 5, 114
BplI GAGNNNNNCTC 2 cut(s) 138, 170
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 2 cut(s) 76, 289
BseBI CCWGG 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 160
BseNI ACTGG 2 cut(s) 76, 289
BseRI GAGGAG 1 cut(s) 159
BseXI GCAGC 3 cut(s) 17, 166, 175
BshFI GGCC 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 160
BsnI GGCC 1 cut(s) 274
BspACI CCGC 1 cut(s) 220
BspANI GGCC 1 cut(s) 274
BspLI GGNNCC 2 cut(s) 37, 280
BspMAI CTGCAG 1 cut(s) 184
BsrI ACTGG 2 cut(s) 76, 289
BssECI CCNNGG 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 276
BstAPI GCANNNNNTGC 1 cut(s) 188
BstDEI CTNAG 1 cut(s) 101
BstENI CCTNNNNNAGG 1 cut(s) 158
BstMWI GCNNNNNNNGC 3 cut(s) 176, 185, 188
BstNI CCWGG 1 cut(s) 276
BstSCI CCNGG 1 cut(s) 274
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 3 cut(s) 17, 166, 175
BstV2I GAAGAC 2 cut(s) 5, 114
BsuRI GGCC 1 cut(s) 274
BtgZI GCGATG 1 cut(s) 80
BtrI CACGTC 1 cut(s) 11
BtsI GCAGTG 2 cut(s) 128, 257
BtsIMutI CAGTG 3 cut(s) 128, 257, 282
CaiI CAGNNNCTG 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 278
CviAII CATG 4 cut(s) 26, 50, 206, 229
CviJI RGCY 6 cut(s) 164, 179, 212, 248, 274, 300
CviKI_1 RGCY 6 cut(s) 164, 179, 212, 248, 274, 300
DdeI CTNAG 1 cut(s) 101
EciI GGCGGA 1 cut(s) 209
Eco130I CCWWGG 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 278
EcoNI CCTNNNNNAGG 1 cut(s) 158
EcoRI GAATTC 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 274
EcoT14I CCWWGG 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 4 cut(s) 29, 53, 209, 232
FaiI YATR 5 cut(s) 27, 51, 63, 207, 230
FatI CATG 4 cut(s) 25, 49, 205, 228
Fnu4HI GCNGC 3 cut(s) 6, 180, 189
Fsp4HI GCNGC 3 cut(s) 6, 180, 189
FspBI CTAG 2 cut(s) 32, 140
GluI GCNGC 3 cut(s) 6, 180, 189
HaeIII GGCC 1 cut(s) 274
Hin1II CATG 4 cut(s) 29, 53, 209, 232
HindIII AAGCTT 1 cut(s) 298
HinfI GANTC 1 cut(s) 290
HphI GGTGA 2 cut(s) 148, 299
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 5 cut(s) 126, 134, 170, 182, 202
HpyF10VI GCNNNNNNNGC 3 cut(s) 176, 185, 188
HpyF3I CTNAG 1 cut(s) 101
HpySE526I ACGT 1 cut(s) 10
Hsp92II CATG 4 cut(s) 29, 53, 209, 232
LpnPI CCDG 5 cut(s) 57, 69, 261, 270, 288
Lsp1109I GCAGC 3 cut(s) 17, 166, 175
LweI GCATC 1 cut(s) 121
MaeI CTAG 2 cut(s) 32, 140
MaeII ACGT 1 cut(s) 10
MaeIII GTNAC 1 cut(s) 83
MboII GAAGA 2 cut(s) 5, 119
MluCI AATT 1 cut(s) 149
MnlI CCTC 3 cut(s) 137, 164, 202
MspR9I CCNGG 1 cut(s) 276
MvaI CCWGG 1 cut(s) 276
MwoI GCNNNNNNNGC 3 cut(s) 176, 185, 188
NlaIII CATG 4 cut(s) 29, 53, 209, 232
NlaIV GGNNCC 2 cut(s) 37, 280
NmeAIII GCCGAG 1 cut(s) 250
PfeI GAWTC 1 cut(s) 290
PkrI GCNGC 3 cut(s) 7, 181, 190
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PspN4I GGNNCC 2 cut(s) 37, 280
PspPI GGNCC 1 cut(s) 278
PstI CTGCAG 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 188
SatI GCNGC 3 cut(s) 6, 180, 189
Sau96I GGNCC 1 cut(s) 278
ScrFI CCNGG 1 cut(s) 276
SetI ASST 3 cut(s) 13, 41, 302
SfaNI GCATC 1 cut(s) 121
SfcI CTRYAG 1 cut(s) 180
SinI GGWCC 1 cut(s) 278
Sse9I AATT 1 cut(s) 149
SsiI CCGC 1 cut(s) 220
SspMI CTAG 2 cut(s) 32, 140
StyD4I CCNGG 1 cut(s) 274
StyI CCWWGG 1 cut(s) 159
TaiI ACGT 1 cut(s) 13
TasI AATT 1 cut(s) 149
TfiI GAWTC 1 cut(s) 290
TscAI CASTG 3 cut(s) 128, 264, 289
TseI GCWGC 3 cut(s) 5, 179, 188
TspRI CASTG 3 cut(s) 128, 264, 289
VpaK11BI GGWCC 1 cut(s) 278
XagI CCTNNNNNAGG 1 cut(s) 158
XapI RAATTY 1 cut(s) 149
XspI CTAG 2 cut(s) 32, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.