Rh1DG292200

Vacuolar protein sorting-associated protein 8 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
51625078 .. 51633109
8032 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG292200.1

Sequence Viewer

Length: 270 bp
ATGACCAACTTGTGGGAACAAAGAATCAATCAAAAGAACTTCAGGCTTACTAGCTTGCAAAGGATCTCCAATTTCACAGAGATTTTGGGTAATAATCCTGTTAATGTGAATGTTGATATGATTGAACTTTCTCTGGAGGTCAATGCCATTGCCAGTATATTGAATGCCTGTATTGGGCTGTGCCAACGGAACCATCTGTTAAATCCCAACGAATCAGAATCAGAAGCTCTGTGGTTTAGCTTACTTGATATGGAAGTTCCAAAGACTTGA

Protein Analysis

89

Amino Acids

10.17

Weight (kDa)

4.75

Isoelectric Point (pI)

43.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017758)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 12
AclWI GGATC 1 cut(s) 71
AcuI CTGAAG 1 cut(s) 25
AfiI CCNNNNNNNGG 2 cut(s) 12, 174
AgsI TTSAA 2 cut(s) 125, 163
AluBI AGCT 3 cut(s) 54, 227, 240
AluI AGCT 3 cut(s) 54, 227, 240
AlwI GGATC 1 cut(s) 71
BccI CCATC 1 cut(s) 201
BfaI CTAG 1 cut(s) 51
BmiI GGNNCC 1 cut(s) 191
BpmI CTGGAG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 174
Bse1I ACTGG 1 cut(s) 153
Bse3DI GCAATG 1 cut(s) 147
BseLI CCNNNNNNNGG 2 cut(s) 12, 174
BseMI GCAATG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 153
BslI CCNNNNNNNGG 2 cut(s) 12, 174
BsmI GAATGC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 191
BspPI GGATC 1 cut(s) 71
BsrDI GCAATG 1 cut(s) 147
BsrI ACTGG 1 cut(s) 153
BssMI GATC 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 56
BstKTI GATC 1 cut(s) 66
BstMBI GATC 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 63
BstYI RGATCY 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 56
CviJI RGCY 5 cut(s) 46, 54, 178, 227, 240
CviKI_1 RGCY 5 cut(s) 46, 54, 178, 227, 240
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 25
FaiI YATR 3 cut(s) 119, 158, 251
FspBI CTAG 1 cut(s) 51
GsuI CTGGAG 1 cut(s) 155
HinfI GANTC 3 cut(s) 24, 212, 218
Hpy188I TCNGA 2 cut(s) 217, 223
Hpy188III TCNNGA 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 58
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 5 cut(s) 28, 111, 119, 166, 181
MaeI CTAG 1 cut(s) 51
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MflI RGATCY 1 cut(s) 63
MluCI AATT 1 cut(s) 70
MnlI CCTC 1 cut(s) 130
MseI TTAA 2 cut(s) 102, 200
Mva1269I GAATGC 1 cut(s) 169
NdeII GATC 1 cut(s) 63
NlaIV GGNNCC 1 cut(s) 191
PctI GAATGC 1 cut(s) 169
PfeI GAWTC 3 cut(s) 24, 212, 218
PflMI CCANNNNNTGG 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 191
PsuI RGATCY 1 cut(s) 63
SaqAI TTAA 2 cut(s) 102, 200
Sau3AI GATC 1 cut(s) 63
SetI ASST 4 cut(s) 56, 141, 229, 242
SgeI CNNG 9 cut(s) 22, 55, 63, 67, 110, 146, 165, 180, 257
Sse9I AATT 1 cut(s) 70
SspMI CTAG 1 cut(s) 51
TasI AATT 1 cut(s) 70
TfiI GAWTC 3 cut(s) 24, 212, 218
Tru1I TTAA 2 cut(s) 102, 200
Tru9I TTAA 2 cut(s) 102, 200
TspGWI ACGGA 1 cut(s) 202
Van91I CCANNNNNTGG 1 cut(s) 12
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.