Rh2AG108700

RNA polymerase I-specific transcription initiation factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
9603320 .. 9607359
4040 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG108700.1

Sequence Viewer

Length: 183 bp
ATGATGGTAGTGAGCTTCCCAGAGAAGACACTAAAAATGAGTGGTGGCCGATTGGTTGAGGTATTTGAAACTCTGCTCAAGTCATTTAAGAAGAATGTAATGACTGCATTCAAGTCAAAATTTGTCCAGGCATCGCCTTCCGTAGTGAAGGAGTTTCTAGGGCAAGTGAATGCAGCTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.6

Weight (kDa)

10.0

Isoelectric Point (pI)

30.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018982)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 46
AcsI RAATTY 1 cut(s) 119
AgsI TTSAA 2 cut(s) 68, 112
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 15, 176
AluI AGCT 2 cut(s) 15, 176
AoxI GGCC 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 119
BbsI GAAGAC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 128
BfaI CTAG 1 cut(s) 158
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
BmsI GCATC 1 cut(s) 140
BpiI GAAGAC 1 cut(s) 32
BpuEI CTTGAG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 128
BshFI GGCC 1 cut(s) 48
BsmI GAATGC 2 cut(s) 107, 175
BsnI GGCC 1 cut(s) 48
BspANI GGCC 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 128
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BstV2I GAAGAC 1 cut(s) 32
BsuRI GGCC 1 cut(s) 48
BtgZI GCGATG 1 cut(s) 117
CviJI RGCY 3 cut(s) 15, 48, 176
CviKI_1 RGCY 3 cut(s) 15, 48, 176
EaeI YGGCCR 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 126
Fnu4HI GCNGC 1 cut(s) 174
Fsp4HI GCNGC 1 cut(s) 174
FspBI CTAG 1 cut(s) 158
GluI GCNGC 1 cut(s) 174
HaeIII GGCC 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 142, 147
HpyCH4V TGCA 2 cut(s) 107, 173
LpnPI CCDG 4 cut(s) 33, 113, 140, 162
LweI GCATC 1 cut(s) 140
MaeI CTAG 1 cut(s) 158
MboII GAAGA 2 cut(s) 37, 103
MluCI AATT 1 cut(s) 119
MnlI CCTC 1 cut(s) 52
MseI TTAA 2 cut(s) 87, 181
MspA1I CMGCKG 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 128
Mva1269I GAATGC 2 cut(s) 107, 175
MvaI CCWGG 1 cut(s) 128
PctI GAATGC 2 cut(s) 107, 175
PkrI GCNGC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PvuII CAGCTG 1 cut(s) 176
SaqAI TTAA 2 cut(s) 87, 181
SatI GCNGC 1 cut(s) 174
ScrFI CCNGG 1 cut(s) 128
SetI ASST 3 cut(s) 17, 63, 178
SfaNI GCATC 1 cut(s) 140
SgeI CNNG 7 cut(s) 32, 91, 124, 139, 140, 170, 176
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 1 cut(s) 119
SspMI CTAG 1 cut(s) 158
StyD4I CCNGG 1 cut(s) 126
TasI AATT 1 cut(s) 119
Tru1I TTAA 2 cut(s) 87, 181
Tru9I TTAA 2 cut(s) 87, 181
TseI GCWGC 1 cut(s) 173
TspGWI ACGGA 1 cut(s) 130
XapI RAATTY 1 cut(s) 119
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.