Rh2CG112700

RNA polymerase I-specific transcription initiation factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0018982
Physical Location & Seq
Reverse (-)
9925168 .. 9933328
8161 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG112700.1

Sequence Viewer

Length: 516 bp
ATGATGGTAGTGAGCTTCCCAGAGAAGACACTAAAAATGAGTGGTGGCCGATTGGTTGAGGTATTTGAAACTCTGCTCAAGTCATTTAAGAAGAATGTGATGACCGCATTCAAGTCAAAATTTGTCCAGTTTGTGATGTTTTATGCATGTGAACTCGATCCATCAACTGTGGTGAGAGATTTGCTTCCACGCTTGCAGAAATTTTGTATTCGCCCTCCGAACTCGCACGTGTTAGATGCTTTATGGATTGTCTTCAAATCACGTGAAGTGGACATGTATATTTTATCTTTGCTATACTATTTTGCTTTGCAGTTATTACTCATTTTGAGTAAGCAACATGGTCTAGACAGGATGAGTGCTGTTGCTTATCTTGCTAGCTATTTGTCTTGTGCGAATTTGGTGGATTGGTGTAACGAATATGTCAAAGAGCAAGATGGTAAAATAAACCCAGAAACCCATGGAATATTTTATTCTACATGCCAGGAAATGACAATCATTGTAGTAGTTTATCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRN3

Protein Analysis

171

Amino Acids

19.81

Weight (kDa)

8.23

Isoelectric Point (pI)

38.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRN3 PF05327 12 - 163 7.1e-17 RNA polymerase I specific transcription initiation factor RRN3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018982)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0096821 RchiOBHm_Chr2g0096831
rosa_samantha Rh2AG108700 Rh2BG110700 Rh2CG112600 Rh2CG112700 Rh2DG112000
rosa_wichuraiana Rw2G008400 Rw2G008410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 105
AclWI GGATC 1 cut(s) 152
AcoI YGGCCR 1 cut(s) 46
AcsI RAATTY 3 cut(s) 119, 200, 394
AcvI CACGTG 2 cut(s) 229, 263
AflIII ACRYGT 2 cut(s) 228, 273
AgsI TTSAA 3 cut(s) 68, 112, 256
AjnI CCWGG 1 cut(s) 480
AluBI AGCT 2 cut(s) 15, 378
AluI AGCT 2 cut(s) 15, 378
AlwI GGATC 1 cut(s) 152
AoxI GGCC 1 cut(s) 46
ApoI RAATTY 3 cut(s) 119, 200, 394
AsuHPI GGTGA 1 cut(s) 184
AsuNHI GCTAGC 1 cut(s) 374
BbrPI CACGTG 2 cut(s) 229, 263
BbsI GAAGAC 2 cut(s) 32, 244
BccI CCATC 2 cut(s) 169, 428
BciT130I CCWGG 1 cut(s) 482
BfaI CTAG 2 cut(s) 344, 375
Bme1390I CCNGG 1 cut(s) 482
BmrFI CCNGG 1 cut(s) 482
BmsI GCATC 1 cut(s) 226
BmtI GCTAGC 1 cut(s) 378
BpiI GAAGAC 2 cut(s) 32, 244
BpuEI CTTGAG 1 cut(s) 62
BsaAI YACGTR 2 cut(s) 229, 263
BsaJI CCNNGG 1 cut(s) 457
Bse1I ACTGG 1 cut(s) 127
BseBI CCWGG 1 cut(s) 482
BseDI CCNNGG 1 cut(s) 457
BseGI GGATG 1 cut(s) 357
BseNI ACTGG 1 cut(s) 127
BshFI GGCC 1 cut(s) 48
BsmI GAATGC 1 cut(s) 107
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 157
Bsp19I CCATGG 1 cut(s) 457
BspACI CCGC 1 cut(s) 105
BspANI GGCC 1 cut(s) 48
BspOI GCTAGC 1 cut(s) 378
BspPI GGATC 1 cut(s) 152
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 457
BssMI GATC 1 cut(s) 157
BssT1I CCWWGG 1 cut(s) 457
Bst2UI CCWGG 1 cut(s) 482
Bst4CI ACNGT 1 cut(s) 169
BstBAI YACGTR 2 cut(s) 229, 263
BstC8I GCNNGC 2 cut(s) 194, 376
BstDSI CCRYGG 1 cut(s) 457
BstF5I GGATG 1 cut(s) 357
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 1 cut(s) 371
BstNI CCWGG 1 cut(s) 482
BstNSI RCATGY 3 cut(s) 150, 277, 480
BstSCI CCNGG 1 cut(s) 480
BstV2I GAAGAC 2 cut(s) 32, 244
BsuRI GGCC 1 cut(s) 48
BtgI CCRYGG 1 cut(s) 457
BtsCI GGATG 1 cut(s) 357
Cac8I GCNNGC 2 cut(s) 194, 376
CviAII CATG 5 cut(s) 147, 274, 338, 458, 477
CviJI RGCY 3 cut(s) 15, 48, 378
CviKI_1 RGCY 3 cut(s) 15, 48, 378
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
EaeI YGGCCR 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 457
Eco72I CACGTG 2 cut(s) 229, 263
EcoRII CCWGG 1 cut(s) 480
EcoT14I CCWWGG 1 cut(s) 457
EcoT22I ATGCAT 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 457
FaeI CATG 5 cut(s) 150, 277, 341, 461, 480
FatI CATG 5 cut(s) 146, 273, 337, 457, 476
FokI GGATG 1 cut(s) 364
FspBI CTAG 2 cut(s) 344, 375
HaeIII GGCC 1 cut(s) 48
Hin1II CATG 5 cut(s) 150, 277, 341, 461, 480
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 2 cut(s) 152, 271
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 1 cut(s) 344
Hpy8I GTNNAC 2 cut(s) 152, 271
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 2 cut(s) 228, 262
HpyCH4V TGCA 3 cut(s) 146, 196, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 371
HpySE526I ACGT 2 cut(s) 228, 262
Hsp92II CATG 5 cut(s) 150, 277, 341, 461, 480
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 6 cut(s) 33, 140, 334, 462, 467, 494
LweI GCATC 1 cut(s) 226
MaeI CTAG 2 cut(s) 344, 375
MaeII ACGT 2 cut(s) 228, 262
MaeIII GTNAC 1 cut(s) 410
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 3 cut(s) 37, 103, 244
MluCI AATT 3 cut(s) 119, 200, 394
MnlI CCTC 2 cut(s) 52, 225
Mph1103I ATGCAT 1 cut(s) 148
MseI TTAA 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 482
Mva1269I GAATGC 1 cut(s) 107
MvaI CCWGG 1 cut(s) 482
MwoI GCNNNNNNNGC 1 cut(s) 371
NcoI CCATGG 1 cut(s) 457
NdeII GATC 1 cut(s) 157
NheI GCTAGC 1 cut(s) 374
NlaIII CATG 5 cut(s) 150, 277, 341, 461, 480
NsiI ATGCAT 1 cut(s) 148
NspI RCATGY 3 cut(s) 150, 277, 480
PciI ACATGT 1 cut(s) 273
PctI GAATGC 1 cut(s) 107
PmaCI CACGTG 2 cut(s) 229, 263
PmlI CACGTG 2 cut(s) 229, 263
Ppu21I YACGTR 2 cut(s) 229, 263
PscI ACATGT 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 480
PspCI CACGTG 2 cut(s) 229, 263
PspGI CCWGG 1 cut(s) 480
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 157
ScrFI CCNGG 1 cut(s) 482
SetI ASST 5 cut(s) 17, 63, 231, 265, 380
SfaNI GCATC 1 cut(s) 226
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 3 cut(s) 119, 200, 394
SsiI CCGC 1 cut(s) 105
SspI AATATT 1 cut(s) 465
SspMI CTAG 2 cut(s) 344, 375
StyD4I CCNGG 1 cut(s) 480
StyI CCWWGG 1 cut(s) 457
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 2 cut(s) 231, 265
TaqI TCGA 1 cut(s) 156
TasI AATT 3 cut(s) 119, 200, 394
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
XapI RAATTY 3 cut(s) 119, 200, 394
XbaI TCTAGA 1 cut(s) 343
XceI RCATGY 3 cut(s) 150, 277, 480
XspI CTAG 2 cut(s) 344, 375
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.