Rh2CG000800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0019978
Physical Location & Seq
Forward (+)
139265 .. 139709
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG000800.1

Sequence Viewer

Length: 258 bp
ATGAGCGAGGCTCCTGTTGTGGTTGCATCAGAGGAAGATCTACAGTTAGGTAAGCCTGGTAGGGTTACCACTCTAACTGCTTCACCAGAGAAATTGAAGGTTCCTACTGGGTCACCGCTGATTGATGCTAAGAGAGGAGAACTCAAGGATGGAATGTTCCGAATCATGAATGGGTTGACTCCGATGATGATGGGGACTTCTGGATCTCAGACAGGTTTCCTCCCCTTTCAGGAACACCTTCTTACTAGTAGGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.13

Weight (kDa)

5.75

Isoelectric Point (pI)

47.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019978)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_MTg0498561
rosa_laevigata RLG00000000459
rosa_multiflora Rmu_sc0003129.1_g000010
rosa_roxburghii Rroxscaffold_2G00119260 Rroxscaffold_3G00257290
rosa_samantha Rh2AG001000 Rh2CG000800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AclWI GGATC 1 cut(s) 211
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 1 cut(s) 97
AhlI ACTAGT 1 cut(s) 245
AjnI CCWGG 1 cut(s) 55
AloI GAACNNNNNNTCC 2 cut(s) 140, 172
AlwI GGATC 1 cut(s) 211
Asp700I GAANNNNTTC 1 cut(s) 237
AsuHPI GGTGA 2 cut(s) 75, 105
BccI CCATC 2 cut(s) 143, 184
BciT130I CCWGG 1 cut(s) 57
BcuI ACTAGT 1 cut(s) 245
BfaI CTAG 1 cut(s) 246
BfmI CTRYAG 1 cut(s) 41
BglII AGATCT 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 57
BmiI GGNNCC 2 cut(s) 12, 102
BmrFI CCNGG 1 cut(s) 57
BmrI ACTGGG 1 cut(s) 117
BmsI GCATC 2 cut(s) 35, 115
BmuI ACTGGG 1 cut(s) 117
BplI GAGNNNNNCTC 3 cut(s) 27, 126, 158
BpuEI CTTGAG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 229
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 112
BseRI GAGGAG 1 cut(s) 150
BslFI GGGAC 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 229
BsmFI GGGAC 1 cut(s) 208
Bsp143I GATC 2 cut(s) 37, 203
BspACI CCGC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 220
BspHI TCATGA 1 cut(s) 165
BspLI GGNNCC 2 cut(s) 12, 102
BspPI GGATC 1 cut(s) 211
BsrI ACTGG 1 cut(s) 112
BssMI GATC 2 cut(s) 37, 203
Bst2UI CCWGG 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 45
BstDEI CTNAG 2 cut(s) 129, 207
BstEII GGTNACC 2 cut(s) 64, 111
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 2 cut(s) 40, 206
BstMBI GATC 2 cut(s) 37, 203
BstNI CCWGG 1 cut(s) 57
BstPI GGTNACC 2 cut(s) 64, 111
BstSCI CCNGG 1 cut(s) 55
BstSFI CTRYAG 1 cut(s) 41
BstX2I RGATCY 2 cut(s) 37, 203
BstYI RGATCY 2 cut(s) 37, 203
BtsCI GGATG 1 cut(s) 154
CciI TCATGA 1 cut(s) 165
CviAII CATG 1 cut(s) 166
CviJI RGCY 2 cut(s) 11, 55
CviKI_1 RGCY 2 cut(s) 11, 55
DdeI CTNAG 2 cut(s) 129, 207
DpnI GATC 2 cut(s) 39, 205
DpnII GATC 2 cut(s) 37, 203
Eco91I GGTNACC 2 cut(s) 64, 111
EcoO65I GGTNACC 2 cut(s) 64, 111
EcoRII CCWGG 1 cut(s) 55
FaeI CATG 1 cut(s) 169
FaiI YATR 1 cut(s) 167
FaqI GGGAC 1 cut(s) 208
FatI CATG 1 cut(s) 165
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 246
Hin1II CATG 1 cut(s) 169
HincII GTYRAC 1 cut(s) 177
HindII GTYRAC 1 cut(s) 177
HinfI GANTC 2 cut(s) 162, 178
HphI GGTGA 2 cut(s) 75, 105
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 4 cut(s) 31, 161, 183, 210
Hpy188III TCNNGA 3 cut(s) 166, 201, 230
Hpy8I GTNNAC 1 cut(s) 177
HpyAV CCTTC 2 cut(s) 91, 248
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 26
HpyF3I CTNAG 2 cut(s) 129, 207
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 2 cut(s) 37, 203
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 8 cut(s) 27, 42, 69, 93, 99, 186, 198, 215
LweI GCATC 2 cut(s) 35, 115
MaeI CTAG 1 cut(s) 246
MaeIII GTNAC 2 cut(s) 64, 111
MalI GATC 2 cut(s) 39, 205
MboI GATC 2 cut(s) 37, 203
MboII GAAGA 1 cut(s) 47
MflI RGATCY 2 cut(s) 37, 203
MluCI AATT 1 cut(s) 92
MlyI GAGTC 1 cut(s) 172
MnlI CCTC 3 cut(s) 25, 128, 230
MroXI GAANNNNTTC 1 cut(s) 237
MspA1I CMGCKG 1 cut(s) 118
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
NdeII GATC 2 cut(s) 37, 203
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 2 cut(s) 12, 102
NmuCI GTSAC 1 cut(s) 111
PagI TCATGA 1 cut(s) 165
PdmI GAANNNNTTC 1 cut(s) 237
PfeI GAWTC 1 cut(s) 162
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
Psp6I CCWGG 1 cut(s) 55
PspEI GGTNACC 2 cut(s) 64, 111
PspGI CCWGG 1 cut(s) 55
PspN4I GGNNCC 2 cut(s) 12, 102
PsuI RGATCY 2 cut(s) 37, 203
Sau3AI GATC 2 cut(s) 37, 203
SchI GAGTC 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 57
SetI ASST 4 cut(s) 52, 102, 217, 240
SfaNI GCATC 2 cut(s) 35, 115
SfcI CTRYAG 1 cut(s) 41
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
SpeI ACTAGT 1 cut(s) 245
Sse9I AATT 1 cut(s) 92
SsiI CCGC 1 cut(s) 116
SspMI CTAG 1 cut(s) 246
StyD4I CCNGG 1 cut(s) 55
TaaI ACNGT 1 cut(s) 45
TasI AATT 1 cut(s) 92
TfiI GAWTC 1 cut(s) 162
TseFI GTSAC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 182
XmnI GAANNNNTTC 1 cut(s) 237
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.