Rh2CG359100

C2 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
48530877 .. 48561265
30389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG359100.1

Sequence Viewer

Length: 303 bp
ATGGTCGACGGATTCAGTGCTGTTGGTTGGTGGAACGCGGACCAATATAGGGCAGTCGAGTCTATAGCTTGCTTGCTTCAATTTTGGACTGGTTGGGATTTAGGCGGAATCGGAACGAGGCAGAGTAAGGGCGTAGTTCAGCACCTTTATTTCGGAAGGAACCCACCCATGTTCACAGAGATGAGACTTCACCGCCTGCCTACTGGTGATGACCATTTGAGCAGTCCCTTGGCCAAGCCAACCAAGGCAAAAAGGCTAAAATTAACAGTCCCTTGGCCAGGACTAAAATTGATAGCTGAGTAA

Protein Analysis

100

Amino Acids

11.26

Weight (kDa)

9.58

Isoelectric Point (pI)

32.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018999)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 6
AccII CGCG 1 cut(s) 38
AciI CCGC 3 cut(s) 38, 105, 193
AcoI YGGCCR 2 cut(s) 231, 275
AfiI CCNNNNNNNGG 2 cut(s) 49, 278
AgsI TTSAA 1 cut(s) 80
AjnI CCWGG 1 cut(s) 277
AluBI AGCT 2 cut(s) 68, 296
AluI AGCT 2 cut(s) 68, 296
Alw26I GTCTC 1 cut(s) 178
AoxI GGCC 2 cut(s) 231, 275
AspS9I GGNCC 1 cut(s) 40
AsuHPI GGTGA 2 cut(s) 182, 218
AvaII GGWCC 1 cut(s) 40
BalI TGGCCA 2 cut(s) 233, 277
BciT130I CCWGG 1 cut(s) 279
BcoDI GTCTC 1 cut(s) 178
BfmI CTRYAG 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 279
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 161
BmrFI CCNGG 1 cut(s) 279
BsaJI CCNNGG 3 cut(s) 228, 243, 272
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 278
Bse1I ACTGG 2 cut(s) 94, 208
BseBI CCWGG 1 cut(s) 279
BseDI CCNNGG 3 cut(s) 228, 243, 272
BseLI CCNNNNNNNGG 2 cut(s) 49, 278
BseMII CTCAG 1 cut(s) 288
BseNI ACTGG 2 cut(s) 94, 208
Bsh1236I CGCG 1 cut(s) 38
BshFI GGCC 2 cut(s) 233, 277
BslFI GGGAC 2 cut(s) 210, 254
BslI CCNNNNNNNGG 2 cut(s) 49, 278
BsmAI GTCTC 1 cut(s) 178
BsmFI GGGAC 2 cut(s) 210, 254
BsnI GGCC 2 cut(s) 233, 277
BspACI CCGC 3 cut(s) 38, 105, 193
BspANI GGCC 2 cut(s) 233, 277
BspCNI CTCAG 1 cut(s) 289
BspFNI CGCG 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 161
BsrI ACTGG 2 cut(s) 94, 208
BssECI CCNNGG 3 cut(s) 228, 243, 272
BssT1I CCWWGG 3 cut(s) 228, 243, 272
Bst2UI CCWGG 1 cut(s) 279
Bst4CI ACNGT 1 cut(s) 268
BstC8I GCNNGC 3 cut(s) 70, 74, 197
BstDEI CTNAG 1 cut(s) 297
BstENI CCTNNNNNAGG 1 cut(s) 276
BstFNI CGCG 1 cut(s) 38
BstMAI GTCTC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 279
BstSCI CCNGG 1 cut(s) 277
BstSFI CTRYAG 1 cut(s) 63
BstUI CGCG 1 cut(s) 38
BsuRI GGCC 2 cut(s) 233, 277
BtsIMutI CAGTG 1 cut(s) 22
Cac8I GCNNGC 3 cut(s) 70, 74, 197
Cfr13I GGNCC 1 cut(s) 40
CviAII CATG 1 cut(s) 169
CviJI RGCY 6 cut(s) 68, 233, 238, 256, 277, 296
CviKI_1 RGCY 6 cut(s) 68, 233, 238, 256, 277, 296
DdeI CTNAG 1 cut(s) 297
EaeI YGGCCR 2 cut(s) 231, 275
EciI GGCGGA 1 cut(s) 120
Eco130I CCWWGG 3 cut(s) 228, 243, 272
Eco47I GGWCC 1 cut(s) 40
EcoNI CCTNNNNNAGG 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 277
EcoT14I CCWWGG 3 cut(s) 228, 243, 272
ErhI CCWWGG 3 cut(s) 228, 243, 272
FaeI CATG 1 cut(s) 172
FaiI YATR 3 cut(s) 48, 65, 170
FaqI GGGAC 2 cut(s) 210, 254
FatI CATG 1 cut(s) 168
FblI GTMKAC 1 cut(s) 6
HaeIII GGCC 2 cut(s) 233, 277
Hin1II CATG 1 cut(s) 172
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 3 cut(s) 12, 59, 108
HphI GGTGA 2 cut(s) 182, 218
Hpy166II GTNNAC 2 cut(s) 7, 174
Hpy188I TCNGA 2 cut(s) 113, 155
Hpy8I GTNNAC 2 cut(s) 7, 174
Hpy99I CGWCG 1 cut(s) 11
HpyAV CCTTC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 268
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 1 cut(s) 172
LpnPI CCDG 5 cut(s) 75, 189, 209, 264, 291
MlsI TGGCCA 2 cut(s) 233, 277
MluCI AATT 3 cut(s) 80, 260, 287
MluNI TGGCCA 2 cut(s) 233, 277
MlyI GAGTC 1 cut(s) 68
MnlI CCTC 1 cut(s) 111
Mox20I TGGCCA 2 cut(s) 233, 277
MscI TGGCCA 2 cut(s) 233, 277
MseI TTAA 1 cut(s) 263
MslI CAYNNNNRTG 1 cut(s) 179
Msp20I TGGCCA 2 cut(s) 233, 277
MspR9I CCNGG 1 cut(s) 279
MvaI CCWGG 1 cut(s) 279
MvnI CGCG 1 cut(s) 38
NlaIII CATG 1 cut(s) 172
NlaIV GGNNCC 1 cut(s) 161
PfeI GAWTC 2 cut(s) 12, 108
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 277
PspGI CCWGG 1 cut(s) 277
PspN4I GGNNCC 1 cut(s) 161
PspPI GGNCC 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 179
SalI GTCGAC 1 cut(s) 5
SaqAI TTAA 1 cut(s) 263
Sau96I GGNCC 1 cut(s) 40
SchI GAGTC 1 cut(s) 68
ScrFI CCNGG 1 cut(s) 279
SetI ASST 3 cut(s) 70, 147, 298
SfcI CTRYAG 1 cut(s) 63
SinI GGWCC 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 179
Sse9I AATT 3 cut(s) 80, 260, 287
SsiI CCGC 3 cut(s) 38, 105, 193
StyD4I CCNGG 1 cut(s) 277
StyI CCWWGG 3 cut(s) 228, 243, 272
TaaI ACNGT 1 cut(s) 268
TaqI TCGA 2 cut(s) 6, 57
TasI AATT 3 cut(s) 80, 260, 287
TfiI GAWTC 2 cut(s) 12, 108
Tru1I TTAA 1 cut(s) 263
Tru9I TTAA 1 cut(s) 263
TscAI CASTG 1 cut(s) 22
TspGWI ACGGA 1 cut(s) 24
TspRI CASTG 1 cut(s) 22
VpaK11BI GGWCC 1 cut(s) 40
XagI CCTNNNNNAGG 1 cut(s) 276
XmiI GTMKAC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.