Rh2CG492700

Protein of unknown function (DUF3593)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0019031
Physical Location & Seq
Forward (+)
65953964 .. 65965922
11959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG492700.1

Sequence Viewer

Length: 339 bp
ATGAGGGAAAGTGAGGTTGAAGAAGATAAAGAAAAGGGCCTAGAACGTAGATGGTATGAATGCATTACCATTGTAAACCAAACACAAACAGATGCAGGGAAGCTGATTATAATCTCGAACAATTGCCCTTCTCTAAGAAAGTCGGAGATCGAGTACTATGCGATGCTTGCCAAGGTTGGAGTTCACCACCACAATGGAACAAAGGTGAACTACAGCTACGGCACGCCCTTGGCGAATGTTGATTGGCTACATGGTGAGGCTGAGTCACTTCTCACTCTAACAAACATATTCATTGTGTTGGGGTTGGGAGAAGCTCTGAGGAAAGCTAAAGAAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3593

Protein Analysis

112

Amino Acids

12.71

Weight (kDa)

5.79

Isoelectric Point (pI)

40.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3593 PF12159 48 - 106 2.2e-13 Protein of unknown function (DUF3593)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019031)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0301591
rosa_samantha Rh2AG507100 Rh2CG492700 Rh4BG366200 Rh4DG083400 Rh5BG113700 Rh6AG319700 Rh7BG140600 Rh7BG461600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 110
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 4 cut(s) 103, 216, 314, 326
AluI AGCT 4 cut(s) 103, 216, 314, 326
AoxI GGCC 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 3 cut(s) 176, 217, 266
BccI CCATC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 235
BcgI CGANNNNNNTGC 2 cut(s) 140, 174
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 211
BmcAI AGTACT 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 37
BmsI GCATC 2 cut(s) 82, 153
BsaBI GATNNNNATC 1 cut(s) 110
BsaJI CCNNGG 2 cut(s) 171, 228
BsaXI ACNNNNNCTCC 2 cut(s) 137, 167
Bse8I GATNNNNATC 1 cut(s) 110
BseDI CCNNGG 2 cut(s) 171, 228
BseJI GATNNNNATC 1 cut(s) 110
BseMII CTCAG 2 cut(s) 252, 308
BshFI GGCC 1 cut(s) 39
BsmI GAATGC 1 cut(s) 65
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 147
BspANI GGCC 1 cut(s) 39
BspCNI CTCAG 2 cut(s) 253, 309
BssECI CCNNGG 2 cut(s) 171, 228
BssMI GATC 1 cut(s) 147
BssT1I CCWWGG 2 cut(s) 171, 228
BstC8I GCNNGC 2 cut(s) 168, 224
BstDEI CTNAG 3 cut(s) 134, 261, 317
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstSFI CTRYAG 1 cut(s) 211
BstXI CCANNNNNNTGG 1 cut(s) 194
BsuRI GGCC 1 cut(s) 39
BtgZI GCGATG 1 cut(s) 176
Cac8I GCNNGC 2 cut(s) 168, 224
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 251
CviJI RGCY 7 cut(s) 39, 103, 216, 247, 260, 314, 326
CviKI_1 RGCY 7 cut(s) 39, 103, 216, 247, 260, 314, 326
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 3 cut(s) 134, 261, 317
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
Eco130I CCWWGG 2 cut(s) 171, 228
EcoO109I RGGNCCY 1 cut(s) 37
EcoT14I CCWWGG 2 cut(s) 171, 228
EcoT22I ATGCAT 1 cut(s) 65
ErhI CCWWGG 2 cut(s) 171, 228
FaeI CATG 1 cut(s) 254
FaiI YATR 5 cut(s) 57, 110, 159, 252, 287
FatI CATG 1 cut(s) 250
FspBI CTAG 1 cut(s) 41
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 1 cut(s) 254
HinfI GANTC 1 cut(s) 263
HphI GGTGA 3 cut(s) 176, 217, 266
Hpy166II GTNNAC 3 cut(s) 76, 184, 208
Hpy188I TCNGA 2 cut(s) 145, 318
Hpy188III TCNNGA 1 cut(s) 115
Hpy8I GTNNAC 3 cut(s) 76, 184, 208
HpyAV CCTTC 1 cut(s) 138
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 63, 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 3 cut(s) 134, 261, 317
HpySE526I ACGT 1 cut(s) 46
Hsp92II CATG 1 cut(s) 254
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 1 cut(s) 81
LweI GCATC 2 cut(s) 82, 153
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 264
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 2 cut(s) 32, 35
MfeI CAATTG 1 cut(s) 121
MluCI AATT 1 cut(s) 121
MlyI GAGTC 1 cut(s) 272
MmeI TCCRAC 2 cut(s) 123, 157
MnlI CCTC 3 cut(s) 7, 250, 312
Mph1103I ATGCAT 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 192
MunI CAATTG 1 cut(s) 121
Mva1269I GAATGC 1 cut(s) 65
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 1 cut(s) 147
NlaIII CATG 1 cut(s) 254
NmuCI GTSAC 1 cut(s) 264
NsiI ATGCAT 1 cut(s) 65
PcsI WCGNNNNNNNCGW 1 cut(s) 230
PctI GAATGC 1 cut(s) 65
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PsiI TTATAA 1 cut(s) 110
PspPI GGNCC 1 cut(s) 37
PsrI GAACNNNNNNTAC 2 cut(s) 200, 232
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 192
Sau3AI GATC 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 37
ScaI AGTACT 1 cut(s) 155
SchI GAGTC 1 cut(s) 272
SetI ASST 8 cut(s) 18, 49, 105, 177, 207, 218, 316, 328
SfaNI GCATC 2 cut(s) 82, 153
SfcI CTRYAG 1 cut(s) 211
SgeI CNNG 9 cut(s) 53, 108, 127, 163, 179, 184, 235, 241, 263
SmiMI CAYNNNNRTG 1 cut(s) 192
Sse9I AATT 1 cut(s) 121
SspMI CTAG 1 cut(s) 41
StyI CCWWGG 2 cut(s) 171, 228
TaiI ACGT 1 cut(s) 49
TaqI TCGA 2 cut(s) 116, 150
TasI AATT 1 cut(s) 121
TatI WGTACW 1 cut(s) 153
TseFI GTSAC 1 cut(s) 264
Tsp45I GTSAC 1 cut(s) 264
TspDTI ATGAA 2 cut(s) 72, 280
XspI CTAG 1 cut(s) 41
ZrmI AGTACT 1 cut(s) 155
Zsp2I ATGCAT 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.