Rh2DG420500
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
60984487 .. 60989635
5149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG420500.1

Sequence Viewer

Length: 165 bp
ATGAAAATAACTCAGGCAAGTGCAAAACCAGCTTTGAACCCTGGACCTTCTGCAGAAAGAACAGAAAGGCCTTCAGGCACAAACCTCAAGGACCTCGCGAAGTTCAAGCCGTCCCTCAACAATCGTCCTGAAGACCAAAGTCATGGAACACTGCTGGTAGTTTAG

Protein Analysis

54

Amino Acids

5.81

Weight (kDa)

9.82

Isoelectric Point (pI)

31.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019110)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 98
AcuI CTGAAG 2 cut(s) 57, 150
AgsI TTSAA 2 cut(s) 37, 106
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AoxI GGCC 1 cut(s) 68
AspS9I GGNCC 2 cut(s) 44, 91
AvaII GGWCC 2 cut(s) 44, 91
BbsI GAAGAC 1 cut(s) 138
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 42
BfmI CTRYAG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 42
Bme18I GGWCC 2 cut(s) 44, 91
BmgT120I GGNCC 2 cut(s) 44, 91
BmrFI CCNGG 1 cut(s) 42
BoxI GACNNNNGTC 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 26
Bsh1236I CGCG 1 cut(s) 98
BshFI GGCC 1 cut(s) 70
BslFI GGGAC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 1 cut(s) 70
Bsp68I TCGCGA 1 cut(s) 98
BspANI GGCC 1 cut(s) 70
BspCNI CTCAG 1 cut(s) 25
BspFNI CGCG 1 cut(s) 98
BspMAI CTGCAG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 12
BstFNI CGCG 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 1 cut(s) 42
BstPAI GACNNNNGTC 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 51
BstUI CGCG 1 cut(s) 98
BstV2I GAAGAC 1 cut(s) 138
BstXI CCANNNNNNTGG 1 cut(s) 143
BsuRI GGCC 1 cut(s) 70
BtsI GCAGTG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 149
BtuMI TCGCGA 1 cut(s) 98
Cfr13I GGNCC 2 cut(s) 44, 91
CviAII CATG 1 cut(s) 143
CviJI RGCY 3 cut(s) 32, 70, 109
CviKI_1 RGCY 3 cut(s) 32, 70, 109
DdeI CTNAG 1 cut(s) 12
Eco147I AGGCCT 1 cut(s) 70
Eco47I GGWCC 2 cut(s) 44, 91
Eco57I CTGAAG 2 cut(s) 57, 150
EcoO109I RGGNCCY 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 40
FaeI CATG 1 cut(s) 146
FaiI YATR 1 cut(s) 144
FaqI GGGAC 1 cut(s) 97
FatI CATG 1 cut(s) 142
HaeIII GGCC 1 cut(s) 70
Hin1II CATG 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 97, 128
HpyAV CCTTC 2 cut(s) 57, 81
HpyCH4V TGCA 2 cut(s) 23, 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 1 cut(s) 146
LpnPI CCDG 6 cut(s) 27, 42, 54, 60, 140, 141
MboII GAAGA 1 cut(s) 143
MnlI CCTC 3 cut(s) 95, 104, 125
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MvnI CGCG 1 cut(s) 98
MwoI GCNNNNNNNGC 1 cut(s) 29
NlaIII CATG 1 cut(s) 146
NruI TCGCGA 1 cut(s) 98
PceI AGGCCT 1 cut(s) 70
PpuMI RGGWCCY 1 cut(s) 91
PshAI GACNNNNGTC 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
PspPI GGNCC 2 cut(s) 44, 91
PspPPI RGGWCCY 1 cut(s) 91
PstI CTGCAG 1 cut(s) 55
RruI TCGCGA 1 cut(s) 98
Sau96I GGNCC 2 cut(s) 44, 91
ScrFI CCNGG 1 cut(s) 42
SetI ASST 4 cut(s) 34, 49, 87, 96
SfcI CTRYAG 1 cut(s) 51
SinI GGWCC 2 cut(s) 44, 91
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
SseBI AGGCCT 1 cut(s) 70
StuI AGGCCT 1 cut(s) 70
StyD4I CCNGG 1 cut(s) 40
TscAI CASTG 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 156
VpaK11BI GGWCC 2 cut(s) 44, 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.