Rh7AG383400
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
50027780 .. 50034743
6964 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG383400.1

Sequence Viewer

Length: 225 bp
ATGTCATCTTTGACTTTGGCAAGTGCAAAACCAGCTTTGAACCCTAGACCTTCTGCAGAAAGAACAGAAACGCCTTCAGTGGGACAAGATTTTCGAGATAGATTCTCAGGTGCGGTTGAAGCATTTTCTAGAAGGAATGGTTATGGGCATGGTTCACATGGTGATAACTCCATACATAGATCAACTGATGATGCGCCATCATCCAAAGATGTGCAATTAAATTAG

Protein Analysis

74

Amino Acids

7.94

Weight (kDa)

6.82

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019110)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 60
AdeI CACNNNGTG 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 80
AgsI TTSAA 2 cut(s) 40, 119
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
ArsI GACNNNNNNTTYG 2 cut(s) 75, 107
AspLEI GCGC 1 cut(s) 196
AsuHPI GGTGA 1 cut(s) 173
BccI CCATC 1 cut(s) 205
BfaI CTAG 2 cut(s) 45, 129
BfmI CTRYAG 1 cut(s) 54
BmsI GCATC 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 120
BslFI GGGAC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 179
BspACI CCGC 1 cut(s) 113
BspCNI CTCAG 1 cut(s) 119
BspMAI CTGCAG 1 cut(s) 58
BssMI GATC 1 cut(s) 179
BstDEI CTNAG 1 cut(s) 106
BstF5I GGATG 1 cut(s) 200
BstHHI GCGC 1 cut(s) 196
BstKTI GATC 1 cut(s) 182
BstMBI GATC 1 cut(s) 179
BstMWI GCNNNNNNNGC 2 cut(s) 32, 119
BstSFI CTRYAG 1 cut(s) 54
BtsCI GGATG 1 cut(s) 200
BtsIMutI CAGTG 1 cut(s) 84
CfoI GCGC 1 cut(s) 196
CviAII CATG 2 cut(s) 149, 158
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
DdeI CTNAG 1 cut(s) 106
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
DraIII CACNNNGTG 1 cut(s) 161
Eco57I CTGAAG 1 cut(s) 60
FaeI CATG 2 cut(s) 152, 161
FaiI YATR 5 cut(s) 144, 150, 159, 173, 177
FaqI GGGAC 1 cut(s) 96
FatI CATG 2 cut(s) 148, 157
FokI GGATG 1 cut(s) 187
FspBI CTAG 2 cut(s) 45, 129
GlaI GCGC 1 cut(s) 195
HhaI GCGC 1 cut(s) 196
Hin1II CATG 2 cut(s) 152, 161
Hin6I GCGC 1 cut(s) 194
HinP1I GCGC 1 cut(s) 194
HinfI GANTC 1 cut(s) 102
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 155
Hpy188III TCNNGA 2 cut(s) 95, 129
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 3 cut(s) 60, 84, 126
HpyCH4V TGCA 3 cut(s) 26, 56, 214
HpyF10VI GCNNNNNNNGC 2 cut(s) 32, 119
HpyF3I CTNAG 1 cut(s) 106
Hsp92II CATG 2 cut(s) 152, 161
HspAI GCGC 1 cut(s) 194
Kzo9I GATC 1 cut(s) 179
LpnPI CCDG 2 cut(s) 45, 93
LweI GCATC 1 cut(s) 181
MaeI CTAG 2 cut(s) 45, 129
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MluCI AATT 2 cut(s) 215, 220
MseI TTAA 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 32, 119
NdeII GATC 1 cut(s) 179
NlaIII CATG 2 cut(s) 152, 161
PfeI GAWTC 1 cut(s) 102
PstI CTGCAG 1 cut(s) 58
SaqAI TTAA 1 cut(s) 218
Sau3AI GATC 1 cut(s) 179
SetI ASST 3 cut(s) 37, 52, 112
SfaNI GCATC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 54
SgeI CNNG 9 cut(s) 33, 44, 57, 98, 107, 120, 141, 161, 170
Sse9I AATT 2 cut(s) 215, 220
SsiI CCGC 1 cut(s) 113
SspMI CTAG 2 cut(s) 45, 129
TaqI TCGA 1 cut(s) 94
TasI AATT 2 cut(s) 215, 220
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TscAI CASTG 1 cut(s) 84
TspRI CASTG 1 cut(s) 84
XbaI TCTAGA 1 cut(s) 128
XspI CTAG 2 cut(s) 45, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.