Rh3AG220300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
22524495 .. 22525039
545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG220300.1

Sequence Viewer

Length: 240 bp
ATGTCGCCACGTACTTCGGCGACTGTGGCGGTAGATGCTCAGGTGCTCCCGTCACCGTCCCCAGGAATCCGACGCTCGCTACATGCTTCTCCGTCCAGTAACCTGCCGAAGCTGAAATCTGCTGAGGCATTGTCACCGGAGGAAGCTTTCCGACACCTTTTGCATGTAGTAATCATCGACGGTGGCACAGTAGCCTCCTCCTCCTACTCCGATGAGGTTGTCATCGCTCTTTCTTCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.19

Weight (kDa)

6.24

Isoelectric Point (pI)

80.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 111
AciI CCGC 1 cut(s) 29
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 62
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 112, 146
AluI AGCT 2 cut(s) 112, 146
Alw21I GWGCWC 1 cut(s) 48
AsuHPI GGTGA 2 cut(s) 45, 126
Bbv12I GWGCWC 1 cut(s) 48
BbvCI CCTCAGC 1 cut(s) 123
BciT130I CCWGG 1 cut(s) 63
BfuAI ACCTGC 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 1 cut(s) 25
Bpu10I CCTNAGC 2 cut(s) 39, 123
BsaAI YACGTR 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 61
BsaWI WCCGGW 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse1I ACTGG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMII CTCAG 2 cut(s) 53, 114
BseNI ACTGG 1 cut(s) 96
BseRI GAGGAG 2 cut(s) 187, 190
BsiHKAI GWGCWC 1 cut(s) 48
BsiSI CCGG 1 cut(s) 137
BslFI GGGAC 1 cut(s) 43
BslI CCNNNNNNNGG 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 48
BspACI CCGC 1 cut(s) 29
BspCNI CTCAG 2 cut(s) 52, 115
BspMI ACCTGC 1 cut(s) 111
BsrI ACTGG 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 4 cut(s) 25, 57, 182, 190
BstBAI YACGTR 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 77
BstDEI CTNAG 2 cut(s) 39, 123
BstMWI GCNNNNNNNGC 2 cut(s) 26, 35
BstNI CCWGG 1 cut(s) 63
BstNSI RCATGY 2 cut(s) 86, 167
BstSCI CCNGG 1 cut(s) 61
BtgZI GCGATG 1 cut(s) 208
BveI ACCTGC 1 cut(s) 111
Cac8I GCNNGC 1 cut(s) 77
CseI GACGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 12
CviAII CATG 2 cut(s) 83, 164
CviJI RGCY 3 cut(s) 112, 146, 194
CviKI_1 RGCY 3 cut(s) 112, 146, 194
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 2 cut(s) 39, 123
EcoRII CCWGG 1 cut(s) 61
FaeI CATG 2 cut(s) 86, 167
FaiI YATR 2 cut(s) 84, 165
FaqI GGGAC 1 cut(s) 43
FatI CATG 2 cut(s) 82, 163
HapII CCGG 1 cut(s) 137
HgaI GACGC 1 cut(s) 81
Hin1II CATG 2 cut(s) 86, 167
HindIII AAGCTT 1 cut(s) 144
HinfI GANTC 1 cut(s) 66
HpaII CCGG 1 cut(s) 137
HphI GGTGA 2 cut(s) 45, 126
Hpy188I TCNGA 3 cut(s) 71, 152, 211
Hpy188III TCNNGA 1 cut(s) 237
Hpy99I CGWCG 2 cut(s) 75, 182
HpyCH4III ACNGT 4 cut(s) 25, 57, 182, 190
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 35
HpyF3I CTNAG 2 cut(s) 39, 123
HpySE526I ACGT 1 cut(s) 10
Hsp92II CATG 2 cut(s) 86, 167
LmnI GCTCC 1 cut(s) 51
LpnPI CCDG 6 cut(s) 26, 48, 75, 109, 116, 150
LweI GCATC 1 cut(s) 25
MaeII ACGT 1 cut(s) 10
MaeIII GTNAC 3 cut(s) 51, 98, 132
MboII GAAGA 1 cut(s) 225
MhlI GDGCHC 1 cut(s) 48
MmeI TCCRAC 2 cut(s) 94, 175
MnlI CCTC 6 cut(s) 118, 133, 205, 208, 208, 211
MspI CCGG 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 2 cut(s) 26, 35
NlaIII CATG 2 cut(s) 86, 167
NmuCI GTSAC 2 cut(s) 51, 132
NspI RCATGY 2 cut(s) 86, 167
PfeI GAWTC 1 cut(s) 66
Ppu21I YACGTR 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
ScrFI CCNGG 1 cut(s) 63
SduI GDGCHC 1 cut(s) 48
SetI ASST 7 cut(s) 13, 45, 105, 114, 148, 159, 219
SfaNI GCATC 1 cut(s) 25
SsiI CCGC 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 4 cut(s) 25, 57, 182, 190
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 177
TfiI GAWTC 1 cut(s) 66
TseFI GTSAC 2 cut(s) 51, 132
Tsp45I GTSAC 2 cut(s) 51, 132
TspGWI ACGGA 1 cut(s) 81
XceI RCATGY 2 cut(s) 86, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.