Rh3BG148700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
12593937 .. 12602137
8201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG148700.1

Sequence Viewer

Length: 264 bp
ATGAGTCAAGTTGGAATTGCTCCAAGTTTTGCAGTAATATGTGAGCATCTACAATTTGATATCATCTCTCTATCAGCATTGCAGGATTGGGTATTAAGAGCCACTCCAATTGCTACAGGTGAAGAAGGTGGTTGCTCTTCTGTTGCTGTGAAGTCTGCAGGACATCAATCCTATTATCAAGAATTCACAACATCCTTTGAAGTGGAACCTTTATATGCAATAGGGAGGGTTTTGAAACTTTCTTCCATACAAGTTCAGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.45

Weight (kDa)

4.82

Isoelectric Point (pI)

46.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 182
AgsI TTSAA 2 cut(s) 200, 235
ApoI RAATTY 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 131
BfaI CTAG 1 cut(s) 262
BfmI CTRYAG 2 cut(s) 114, 156
BmiI GGNNCC 1 cut(s) 207
BmsI GCATC 1 cut(s) 55
Bse3DI GCAATG 1 cut(s) 77
BseGI GGATG 1 cut(s) 191
BseMI GCAATG 1 cut(s) 77
BspLI GGNNCC 1 cut(s) 207
BspMAI CTGCAG 1 cut(s) 160
BspQI GCTCTTC 1 cut(s) 142
BsrDI GCAATG 1 cut(s) 77
Bst6I CTCTTC 1 cut(s) 142
BstF5I GGATG 1 cut(s) 191
BstSFI CTRYAG 2 cut(s) 114, 156
BtsCI GGATG 1 cut(s) 191
CspCI CAANNNNNGTGG 2 cut(s) 91, 126
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
Eam1104I CTCTTC 1 cut(s) 142
EarI CTCTTC 1 cut(s) 142
Eco32I GATATC 1 cut(s) 61
EcoRI GAATTC 1 cut(s) 182
EcoRV GATATC 1 cut(s) 61
FaiI YATR 4 cut(s) 40, 214, 216, 248
FokI GGATG 1 cut(s) 178
FspBI CTAG 1 cut(s) 262
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 131
Hpy188III TCNNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 4 cut(s) 32, 82, 158, 218
LguI GCTCTTC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 68, 102, 144
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 262
MboII GAAGA 3 cut(s) 129, 134, 234
MfeI CAATTG 1 cut(s) 108
MluCI AATT 4 cut(s) 15, 53, 108, 182
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 1 cut(s) 219
MseI TTAA 1 cut(s) 95
MunI CAATTG 1 cut(s) 108
NlaIV GGNNCC 1 cut(s) 207
PciSI GCTCTTC 1 cut(s) 142
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 207
PstI CTGCAG 1 cut(s) 160
SapI GCTCTTC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 95
SchI GAGTC 1 cut(s) 13
SetI ASST 3 cut(s) 121, 130, 211
SfaNI GCATC 1 cut(s) 55
SfcI CTRYAG 2 cut(s) 114, 156
SgeI CNNG 6 cut(s) 20, 36, 95, 129, 171, 191
Sse9I AATT 4 cut(s) 15, 53, 108, 182
SspMI CTAG 1 cut(s) 262
TasI AATT 4 cut(s) 15, 53, 108, 182
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
XapI RAATTY 1 cut(s) 182
XspI CTAG 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.