Rh3BG316800

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
32454342 .. 32456118
1777 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG316800.1

Sequence Viewer

Length: 243 bp
ATGGATAAGGTGGAGGAGTGGCAAAGAGCACTCGGCGATGTTGCAGACATGGGAGGGATGGTTTTAGGAGATCAGTATGAGTCACAGTTCATCCAACATATTGTTCATGAAACTCTGAAAATGCTGAATGACTCGTTATTTAAAGATCAGTGGTGGCCAATGGATAACCAAGATATTTCTCATTTTCTCTTTCTGTCTCCTCTTTTCTACTATACTCAATTAATTGAAAACTATACTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.59

Weight (kDa)

4.29

Isoelectric Point (pI)

32.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 155
AgsI TTSAA 1 cut(s) 227
AjuI GAANNNNNNNTTGG 2 cut(s) 87, 119
Alw21I GWGCWC 1 cut(s) 31
Alw26I GTCTC 1 cut(s) 201
AoxI GGCC 1 cut(s) 155
AseI ATTAAT 1 cut(s) 221
BalI TGGCCA 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 31
BccI CCATC 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 201
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
BseGI GGATG 2 cut(s) 63, 90
BseRI GAGGAG 2 cut(s) 29, 189
BshFI GGCC 1 cut(s) 157
BsiHKAI GWGCWC 1 cut(s) 31
BsmAI GTCTC 1 cut(s) 201
BsnI GGCC 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 70, 145
BspANI GGCC 1 cut(s) 157
BspHI TCATGA 1 cut(s) 106
BssMI GATC 2 cut(s) 70, 145
Bst4CI ACNGT 1 cut(s) 87
BstF5I GGATG 2 cut(s) 63, 90
BstKTI GATC 2 cut(s) 73, 148
BstMAI GTCTC 1 cut(s) 201
BstMBI GATC 2 cut(s) 70, 145
BsuRI GGCC 1 cut(s) 157
BtgZI GCGATG 1 cut(s) 51
BtsCI GGATG 2 cut(s) 63, 90
BtsIMutI CAGTG 1 cut(s) 155
CciI TCATGA 1 cut(s) 106
CviAII CATG 2 cut(s) 49, 107
CviJI RGCY 1 cut(s) 157
CviKI_1 RGCY 1 cut(s) 157
DpnI GATC 2 cut(s) 72, 147
DpnII GATC 2 cut(s) 70, 145
DraI TTTAAA 1 cut(s) 142
EaeI YGGCCR 1 cut(s) 155
FaeI CATG 2 cut(s) 52, 110
FaiI YATR 6 cut(s) 50, 78, 99, 108, 213, 234
FatI CATG 2 cut(s) 48, 106
FokI GGATG 2 cut(s) 70, 77
HaeIII GGCC 1 cut(s) 157
Hin1II CATG 2 cut(s) 52, 110
HinfI GANTC 2 cut(s) 80, 131
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 44
Hsp92II CATG 2 cut(s) 52, 110
Kzo9I GATC 2 cut(s) 70, 145
MaeIII GTNAC 1 cut(s) 81
MalI GATC 2 cut(s) 72, 147
MboI GATC 2 cut(s) 70, 145
MhlI GDGCHC 1 cut(s) 31
MlsI TGGCCA 1 cut(s) 157
MluCI AATT 2 cut(s) 218, 222
MluNI TGGCCA 1 cut(s) 157
MlyI GAGTC 2 cut(s) 89, 125
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 3 cut(s) 7, 47, 210
Mox20I TGGCCA 1 cut(s) 157
MscI TGGCCA 1 cut(s) 157
MseI TTAA 2 cut(s) 141, 221
Msp20I TGGCCA 1 cut(s) 157
NdeII GATC 2 cut(s) 70, 145
NlaIII CATG 2 cut(s) 52, 110
NmeAIII GCCGAG 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 81
PagI TCATGA 1 cut(s) 106
PleI GAGTC 2 cut(s) 88, 125
PpsI GAGTC 2 cut(s) 88, 125
PshBI ATTAAT 1 cut(s) 221
SaqAI TTAA 2 cut(s) 141, 221
Sau3AI GATC 2 cut(s) 70, 145
SchI GAGTC 2 cut(s) 89, 125
SduI GDGCHC 1 cut(s) 31
SetI ASST 1 cut(s) 12
SgeI CNNG 5 cut(s) 44, 61, 119, 145, 182
Sse9I AATT 2 cut(s) 218, 222
TaaI ACNGT 1 cut(s) 87
TasI AATT 2 cut(s) 218, 222
Tru1I TTAA 2 cut(s) 141, 221
Tru9I TTAA 2 cut(s) 141, 221
TscAI CASTG 1 cut(s) 155
TseFI GTSAC 1 cut(s) 81
Tsp45I GTSAC 1 cut(s) 81
TspDTI ATGAA 3 cut(s) 79, 95, 123
TspRI CASTG 1 cut(s) 155
VspI ATTAAT 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.