Rh3CG024600

transcription coactivator activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
1693287 .. 1694681
1395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG024600.1

Sequence Viewer

Length: 366 bp
ATGATGCACTACAAGGAGGAAAAAGAGGCAAAGAAAGAAGCTTTCAGGAAGTACTTGGAATCCAGTGGAGTTCTTGATGCCCTCACCAAAGTTTTGGTTGCATTGTACGAGCAGAATGACAAGCCTTCCTCTGCGCTCGAGTTTGTTCAACAAAAGTTAGGAGGTCCATCTTTGTCCGAGTATGAAAAGCTACAGGCTGAATTATCAGATCTGCAGATGAAGTATAACCAACTTTTCACAGCTTACCAAGAGACCAGTGCAGAGTTGGAGGAACTTAAGAGCTCACAAGCGCATACAACACATAATGAAGCACCAGGTTCTACCAAGGAGACCACTGCTGAGGAGGCCCAAAAGGAAAAGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.72

Weight (kDa)

5.03

Isoelectric Point (pI)

45.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015361)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G14045 AT2G14045 AT2G14045 AT2G14045
fragaria_vesca FvH4_6g02371
malus_domestica MD12G1244800.v1.1
prunus_persica Prupe.6G347400_v2.0.a1
pyrus_communis pycom12g22460
rosa_chinensis RchiOBHm_Chr3g0450141
rosa_laevigata RLG00000025752
rosa_multiflora Rmu_ssc0000116.1_g000067
rosa_samantha Rh3AG025100 Rh3BG025700 Rh3CG024600 Rh3DG025700
rosa_wichuraiana Rw3G002010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 53, 107
AflII CTTAAG 1 cut(s) 275
AgsI TTSAA 1 cut(s) 149
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 4 cut(s) 41, 190, 242, 282
AluI AGCT 4 cut(s) 41, 190, 242, 282
Alw21I GWGCWC 1 cut(s) 284
Alw26I GTCTC 2 cut(s) 245, 323
Ama87I CYCGRG 1 cut(s) 137
AoxI GGCC 1 cut(s) 345
AspLEI GCGC 2 cut(s) 136, 292
AspS9I GGNCC 2 cut(s) 164, 346
AsuHPI GGTGA 1 cut(s) 76
AvaI CYCGRG 1 cut(s) 137
AvaII GGWCC 1 cut(s) 164
BanII GRGCYC 1 cut(s) 284
Bbv12I GWGCWC 1 cut(s) 284
BbvCI CCTCAGC 1 cut(s) 339
BccI CCATC 1 cut(s) 175
BciT130I CCWGG 1 cut(s) 315
BcoDI GTCTC 2 cut(s) 245, 323
BfmI CTRYAG 2 cut(s) 191, 212
BfrI CTTAAG 1 cut(s) 275
BglII AGATCT 1 cut(s) 208
BmcAI AGTACT 1 cut(s) 53
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 1 cut(s) 164
BmeT110I CYCGRG 1 cut(s) 137
BmgT120I GGNCC 2 cut(s) 164, 346
BmrFI CCNGG 1 cut(s) 315
BmsI GCATC 1 cut(s) 67
Bpu10I CCTNAGC 1 cut(s) 339
BsaI GGTCTC 2 cut(s) 245, 323
BsaJI CCNNGG 1 cut(s) 324
Bse1I ACTGG 2 cut(s) 63, 255
BseBI CCWGG 1 cut(s) 315
BseDI CCNNGG 1 cut(s) 324
BseMII CTCAG 1 cut(s) 330
BseNI ACTGG 2 cut(s) 63, 255
BseRI GAGGAG 1 cut(s) 356
BsgI GTGCAG 1 cut(s) 279
BshFI GGCC 1 cut(s) 347
BsiHKAI GWGCWC 1 cut(s) 284
BsiHKCI CYCGRG 1 cut(s) 137
BsmAI GTCTC 2 cut(s) 245, 323
BsnI GGCC 1 cut(s) 347
Bso31I GGTCTC 2 cut(s) 245, 323
BsoBI CYCGRG 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 284
Bsp143I GATC 1 cut(s) 208
BspANI GGCC 1 cut(s) 347
BspCNI CTCAG 1 cut(s) 331
BspMAI CTGCAG 1 cut(s) 216
BspTI CTTAAG 1 cut(s) 275
BspTNI GGTCTC 2 cut(s) 245, 323
BsrI ACTGG 2 cut(s) 63, 255
BssECI CCNNGG 1 cut(s) 324
BssMI GATC 1 cut(s) 208
BssT1I CCWWGG 1 cut(s) 324
Bst2UI CCWGG 1 cut(s) 315
BstAFI CTTAAG 1 cut(s) 275
BstDEI CTNAG 1 cut(s) 339
BstHHI GCGC 2 cut(s) 136, 292
BstKTI GATC 1 cut(s) 211
BstMAI GTCTC 2 cut(s) 245, 323
BstMBI GATC 1 cut(s) 208
BstMWI GCNNNNNNNGC 1 cut(s) 344
BstNI CCWGG 1 cut(s) 315
BstSCI CCNGG 1 cut(s) 313
BstSFI CTRYAG 2 cut(s) 191, 212
BstX2I RGATCY 1 cut(s) 208
BstXI CCANNNNNNTGG 1 cut(s) 94
BstYI RGATCY 1 cut(s) 208
BsuRI GGCC 1 cut(s) 347
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 3 cut(s) 70, 262, 333
CfoI GCGC 2 cut(s) 136, 292
Cfr13I GGNCC 2 cut(s) 164, 346
CsiI ACCWGGT 1 cut(s) 313
Csp6I GTAC 2 cut(s) 52, 106
CviJI RGCY 7 cut(s) 41, 124, 190, 197, 242, 282, 347
CviKI_1 RGCY 7 cut(s) 41, 124, 190, 197, 242, 282, 347
CviQI GTAC 2 cut(s) 52, 106
DdeI CTNAG 1 cut(s) 339
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Ecl136II GAGCTC 1 cut(s) 282
Eco130I CCWWGG 1 cut(s) 324
Eco24I GRGCYC 1 cut(s) 284
Eco31I GGTCTC 2 cut(s) 245, 323
Eco47I GGWCC 1 cut(s) 164
Eco53kI GAGCTC 1 cut(s) 282
Eco88I CYCGRG 1 cut(s) 137
EcoICRI GAGCTC 1 cut(s) 282
EcoRII CCWGG 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 324
EcoT38I GRGCYC 1 cut(s) 284
ErhI CCWWGG 1 cut(s) 324
FaiI YATR 4 cut(s) 183, 225, 294, 303
FriOI GRGCYC 1 cut(s) 284
GlaI GCGC 2 cut(s) 135, 291
HaeIII GGCC 1 cut(s) 347
HhaI GCGC 2 cut(s) 136, 292
Hin6I GCGC 2 cut(s) 134, 290
HinP1I GCGC 2 cut(s) 134, 290
HindIII AAGCTT 1 cut(s) 39
HinfI GANTC 1 cut(s) 59
HphI GGTGA 1 cut(s) 76
Hpy188I TCNGA 2 cut(s) 178, 208
Hpy188III TCNNGA 2 cut(s) 46, 74
HpyAV CCTTC 1 cut(s) 135
HpyCH4V TGCA 4 cut(s) 7, 101, 214, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 344
HpyF3I CTNAG 1 cut(s) 339
HspAI GCGC 2 cut(s) 134, 290
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 6 cut(s) 31, 76, 179, 268, 300, 327
LweI GCATC 1 cut(s) 67
MabI ACCWGGT 1 cut(s) 313
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MflI RGATCY 1 cut(s) 208
MhlI GDGCHC 1 cut(s) 284
MluCI AATT 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 8 cut(s) 10, 19, 92, 139, 155, 262, 334, 337
MseI TTAA 1 cut(s) 276
MspCI CTTAAG 1 cut(s) 275
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
MwoI GCNNNNNNNGC 1 cut(s) 344
NdeII GATC 1 cut(s) 208
PaeR7I CTCGAG 1 cut(s) 137
PfeI GAWTC 1 cut(s) 59
Psp124BI GAGCTC 1 cut(s) 284
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
PspPI GGNCC 2 cut(s) 164, 346
PspXI VCTCGAGB 1 cut(s) 137
PstI CTGCAG 1 cut(s) 216
PsuI RGATCY 1 cut(s) 208
RsaI GTAC 2 cut(s) 53, 107
RsaNI GTAC 2 cut(s) 52, 106
SacI GAGCTC 1 cut(s) 284
SaqAI TTAA 1 cut(s) 276
Sau3AI GATC 1 cut(s) 208
Sau96I GGNCC 2 cut(s) 164, 346
ScaI AGTACT 1 cut(s) 53
ScrFI CCNGG 1 cut(s) 315
SduI GDGCHC 1 cut(s) 284
SetI ASST 6 cut(s) 43, 166, 192, 244, 284, 319
SexAI ACCWGGT 1 cut(s) 313
SfaNI GCATC 1 cut(s) 67
SfcI CTRYAG 2 cut(s) 191, 212
Sfr274I CTCGAG 1 cut(s) 137
SinI GGWCC 1 cut(s) 164
SlaI CTCGAG 1 cut(s) 137
SmlI CTYRAG 2 cut(s) 137, 275
SmoI CTYRAG 2 cut(s) 137, 275
Sse9I AATT 1 cut(s) 200
SstI GAGCTC 1 cut(s) 284
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 324
TaqI TCGA 1 cut(s) 138
TasI AATT 1 cut(s) 200
TatI WGTACW 1 cut(s) 51
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TscAI CASTG 3 cut(s) 70, 262, 340
TspDTI ATGAA 3 cut(s) 198, 233, 321
TspRI CASTG 3 cut(s) 70, 262, 340
Vha464I CTTAAG 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 164
XcmI CCANNNNNNNNNTGG 1 cut(s) 262
XhoI CTCGAG 1 cut(s) 137
ZrmI AGTACT 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.