Rh3CG162100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
13652387 .. 13659607
7221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG162100.1

Sequence Viewer

Length: 306 bp
ATGGATATTGTACTGTTTGTATCTGGCAAATTTGATGCAGAAATTTCTCATGAACTTGCTCTTGTAGAACTGAACTTGGAACGACGAGTTAAAGCTGTTGAAGCAGAATTTGTTACCTTGGACCTAGGATATTTATCAATGATTGCCTTTGACTCCAAGATTGAAGATCCAATGAAATTGGAAAGTAAGGTAGAGAAAAGTAATTGCCTGGAAGAAGAAATCATGTCAGCAGAGCAATTGAAGCATGAGGAGAGATCAATGGAAGCATCATCATGTCAAATGGCTATGGAATTGAAATGTCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.52

Weight (kDa)

4.53

Isoelectric Point (pI)

50.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 161
AcsI RAATTY 3 cut(s) 29, 42, 107
AfaI GTAC 1 cut(s) 12
AgsI TTSAA 4 cut(s) 101, 164, 241, 295
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwI GGATC 1 cut(s) 161
ApoI RAATTY 3 cut(s) 29, 42, 107
AspA2I CCTAGG 1 cut(s) 124
AspS9I GGNCC 1 cut(s) 121
AvaII GGWCC 1 cut(s) 121
AvrII CCTAGG 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 209
BfaI CTAG 1 cut(s) 125
BlnI CCTAGG 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 209
BmsI GCATC 2 cut(s) 25, 275
BsaBI GATNNNNATC 1 cut(s) 133
BsaJI CCNNGG 2 cut(s) 117, 124
Bse8I GATNNNNATC 1 cut(s) 133
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 2 cut(s) 117, 124
BseJI GATNNNNATC 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 263
Bsp143I GATC 2 cut(s) 166, 254
BspHI TCATGA 1 cut(s) 49
BspPI GGATC 1 cut(s) 161
BssECI CCNNGG 2 cut(s) 117, 124
BssMI GATC 2 cut(s) 166, 254
BssT1I CCWWGG 2 cut(s) 117, 124
Bst2UI CCWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 15
BstKTI GATC 2 cut(s) 169, 257
BstMBI GATC 2 cut(s) 166, 254
BstMWI GCNNNNNNNGC 2 cut(s) 101, 241
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 166
BstYI RGATCY 1 cut(s) 166
CciI TCATGA 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 11
CviAII CATG 4 cut(s) 50, 223, 245, 273
CviJI RGCY 2 cut(s) 95, 284
CviKI_1 RGCY 2 cut(s) 95, 284
CviQI GTAC 1 cut(s) 11
DpnI GATC 2 cut(s) 168, 256
DpnII GATC 2 cut(s) 166, 254
Eco130I CCWWGG 2 cut(s) 117, 124
Eco47I GGWCC 1 cut(s) 121
EcoRII CCWGG 1 cut(s) 207
EcoT14I CCWWGG 2 cut(s) 117, 124
ErhI CCWWGG 2 cut(s) 117, 124
FaeI CATG 4 cut(s) 53, 226, 248, 276
FaiI YATR 5 cut(s) 51, 224, 246, 274, 287
FatI CATG 4 cut(s) 49, 222, 244, 272
FspBI CTAG 1 cut(s) 125
Hin1II CATG 4 cut(s) 53, 226, 248, 276
HinfI GANTC 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 50
Hpy99I CGWCG 1 cut(s) 87
HpyCH4III ACNGT 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 241
Hsp92II CATG 4 cut(s) 53, 226, 248, 276
Kzo9I GATC 2 cut(s) 166, 254
LpnPI CCDG 3 cut(s) 9, 194, 221
LweI GCATC 2 cut(s) 25, 275
MaeI CTAG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 112
MalI GATC 2 cut(s) 168, 256
MboI GATC 2 cut(s) 166, 254
MboII GAAGA 3 cut(s) 176, 224, 227
MfeI CAATTG 1 cut(s) 236
MflI RGATCY 1 cut(s) 166
MluCI AATT 7 cut(s) 29, 42, 107, 176, 202, 236, 290
MlyI GAGTC 1 cut(s) 146
MnlI CCTC 1 cut(s) 241
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 271
MspR9I CCNGG 1 cut(s) 209
MunI CAATTG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 2 cut(s) 101, 241
NdeII GATC 2 cut(s) 166, 254
NlaIII CATG 4 cut(s) 53, 226, 248, 276
PagI TCATGA 1 cut(s) 49
PleI GAGTC 1 cut(s) 146
PpsI GAGTC 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PspPI GGNCC 1 cut(s) 121
PsuI RGATCY 1 cut(s) 166
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 271
SaqAI TTAA 1 cut(s) 90
Sau3AI GATC 2 cut(s) 166, 254
Sau96I GGNCC 1 cut(s) 121
SchI GAGTC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 209
SetI ASST 4 cut(s) 97, 119, 126, 192
SfaNI GCATC 2 cut(s) 25, 275
SinI GGWCC 1 cut(s) 121
SmiMI CAYNNNNRTG 1 cut(s) 271
Sse9I AATT 7 cut(s) 29, 42, 107, 176, 202, 236, 290
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 1 cut(s) 207
StyI CCWWGG 2 cut(s) 117, 124
TaaI ACNGT 1 cut(s) 15
TasI AATT 7 cut(s) 29, 42, 107, 176, 202, 236, 290
TatI WGTACW 1 cut(s) 10
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TspDTI ATGAA 2 cut(s) 66, 188
VpaK11BI GGWCC 1 cut(s) 121
XapI RAATTY 3 cut(s) 29, 42, 107
XmaJI CCTAGG 1 cut(s) 124
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.