Rh3DG342600

Phosphoethanolamine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
38444259 .. 38444557
299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG342600.1

Sequence Viewer

Length: 216 bp
ATGAAAGTGCTTCAGTGGGAATTAAATGCCATTGAGAAGGACAAGGATGCATTCATTGAGGACTTTTCTAAGGAGGACTACAATGACATGGTGGATGGAAGGCAAAGCTGGTTAGGACTAACTCTAGAGAGAAGTGTGGCCTCTTCATTGCCAAGAATAAATGATTATGACACCTTAAGTTTTGCATATGCAAATGCAATATTGTACTCTAGTTAG

Protein Analysis

71

Amino Acids

8.2

Weight (kDa)

4.29

Isoelectric Point (pI)

57.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 206
AflII CTTAAG 1 cut(s) 175
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AoxI GGCC 1 cut(s) 138
BccI CCATC 1 cut(s) 89
BfaI CTAG 2 cut(s) 125, 210
BfrI CTTAAG 1 cut(s) 175
BmsI GCATC 1 cut(s) 37
Bse3DI GCAATG 1 cut(s) 146
BseGI GGATG 2 cut(s) 52, 100
BseMI GCAATG 1 cut(s) 146
BshFI GGCC 1 cut(s) 140
BsmI GAATGC 1 cut(s) 50
BsnI GGCC 1 cut(s) 140
BspANI GGCC 1 cut(s) 140
BspTI CTTAAG 1 cut(s) 175
BsrDI GCAATG 1 cut(s) 146
Bst6I CTCTTC 1 cut(s) 148
BstAFI CTTAAG 1 cut(s) 175
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 2 cut(s) 52, 100
BsuRI GGCC 1 cut(s) 140
BtsCI GGATG 2 cut(s) 52, 100
BtsIMutI CAGTG 1 cut(s) 20
Csp6I GTAC 1 cut(s) 205
CviAII CATG 1 cut(s) 88
CviJI RGCY 2 cut(s) 108, 140
CviKI_1 RGCY 2 cut(s) 108, 140
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 148
EarI CTCTTC 1 cut(s) 148
EcoT22I ATGCAT 1 cut(s) 52
FaeI CATG 1 cut(s) 91
FaiI YATR 4 cut(s) 89, 168, 187, 189
FatI CATG 1 cut(s) 87
FauNDI CATATG 1 cut(s) 187
FokI GGATG 2 cut(s) 59, 107
FspBI CTAG 2 cut(s) 125, 210
HaeIII GGCC 1 cut(s) 140
Hin1II CATG 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 125
HpyAV CCTTC 2 cut(s) 31, 93
HpyCH4V TGCA 4 cut(s) 50, 185, 191, 197
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 91
LpnPI CCDG 1 cut(s) 94
LweI GCATC 1 cut(s) 37
MaeI CTAG 2 cut(s) 125, 210
MboII GAAGA 1 cut(s) 135
MluCI AATT 1 cut(s) 20
MnlI CCTC 3 cut(s) 52, 67, 151
Mph1103I ATGCAT 1 cut(s) 52
MseI TTAA 2 cut(s) 23, 176
MspCI CTTAAG 1 cut(s) 175
Mva1269I GAATGC 1 cut(s) 50
NdeI CATATG 1 cut(s) 187
NlaIII CATG 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 52
PctI GAATGC 1 cut(s) 50
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SaqAI TTAA 2 cut(s) 23, 176
SetI ASST 2 cut(s) 110, 176
SfaNI GCATC 1 cut(s) 37
SgeI CNNG 5 cut(s) 55, 100, 121, 137, 165
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 1 cut(s) 20
SspI AATATT 1 cut(s) 201
SspMI CTAG 2 cut(s) 125, 210
TasI AATT 1 cut(s) 20
TatI WGTACW 1 cut(s) 204
Tru1I TTAA 2 cut(s) 23, 176
Tru9I TTAA 2 cut(s) 23, 176
TscAI CASTG 1 cut(s) 20
TspDTI ATGAA 3 cut(s) 17, 43, 135
TspRI CASTG 1 cut(s) 20
Vha464I CTTAAG 1 cut(s) 175
XbaI TCTAGA 1 cut(s) 124
XspI CTAG 2 cut(s) 125, 210
Zsp2I ATGCAT 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.