Rh4DG301600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
52319332 .. 52329575
10244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG301600.1

Sequence Viewer

Length: 204 bp
ATGCCCTGTCCAACCTACGTTTCACCTCTCGCAACTGGATTAACAGTCTATGAGTTGTCTTTCTTTAATAAGGTTAGAGTATCTGGTATCCCTGAGTATCTCCTATTTTTTGGCTGTGATTGTAGACATCTTGGAGATGACTTAGGTAAGAATGCTTTAGGTGAATATAATGAGTGTTTCCTAGTAGTTATATATGGATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.52

Weight (kDa)

4.7

Isoelectric Point (pI)

31.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 124
AjuI GAANNNNNNNTTGG 1 cut(s) 36
AsuHPI GGTGA 2 cut(s) 15, 173
BciVI GTATCC 1 cut(s) 98
BfaI CTAG 1 cut(s) 182
BfuI GTATCC 1 cut(s) 98
Bse1I ACTGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 84
BseNI ACTGG 1 cut(s) 40
BsmI GAATGC 1 cut(s) 157
BspCNI CTCAG 1 cut(s) 85
BsrI ACTGG 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 93, 142
BsuI GTATCC 1 cut(s) 98
CviJI RGCY 1 cut(s) 114
CviKI_1 RGCY 1 cut(s) 114
DdeI CTNAG 2 cut(s) 93, 142
FaiI YATR 5 cut(s) 51, 168, 191, 193, 195
FblI GTMKAC 1 cut(s) 124
FspBI CTAG 1 cut(s) 182
HphI GGTGA 2 cut(s) 15, 173
Hpy166II GTNNAC 1 cut(s) 125
Hpy8I GTNNAC 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 93, 142
HpySE526I ACGT 1 cut(s) 18
LpnPI CCDG 4 cut(s) 19, 21, 69, 105
MaeI CTAG 1 cut(s) 182
MaeII ACGT 1 cut(s) 18
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 1 cut(s) 36
MseI TTAA 3 cut(s) 41, 66, 202
Mva1269I GAATGC 1 cut(s) 157
PctI GAATGC 1 cut(s) 157
SaqAI TTAA 3 cut(s) 41, 66, 202
SetI ASST 6 cut(s) 17, 21, 28, 75, 148, 163
SgeI CNNG 7 cut(s) 18, 41, 48, 96, 104, 143, 194
SspMI CTAG 1 cut(s) 182
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 1 cut(s) 21
Tru1I TTAA 3 cut(s) 41, 66, 202
Tru9I TTAA 3 cut(s) 41, 66, 202
XmiI GTMKAC 1 cut(s) 124
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.