Rh4AG033100

DNA-directed RNA polymerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
7113222 .. 7113422
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG033100.1

Sequence Viewer

Length: 201 bp
ATGCCAGATTACAGTTATGTGCCAGGGGAGAATCTTGTGTTTTTGAATGACAAGAATCACAAGATGTCTAAGATTGAGAAAGGTGTCACAGTTCGCTTCATTGCCATTGGGTCCAAGTGGCTTGAAGTAGAAAGGGAATTTCAGGCTTTGGTTGGTTTACTTGTTGATTATCATGGACCAGTTTCAGGATCAAGTATCTAA

Protein Analysis

66

Amino Acids

7.41

Weight (kDa)

6.03

Isoelectric Point (pI)

38.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 196
AcsI RAATTY 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 2 cut(s) 46, 125
AjnI CCWGG 1 cut(s) 22
AlwI GGATC 1 cut(s) 196
ApoI RAATTY 1 cut(s) 137
AspS9I GGNCC 2 cut(s) 111, 176
AvaII GGWCC 2 cut(s) 111, 176
BciT130I CCWGG 1 cut(s) 24
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 2 cut(s) 111, 176
BmgT120I GGNCC 2 cut(s) 111, 176
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 185
Bse1I ACTGG 1 cut(s) 179
Bse3DI GCAATG 1 cut(s) 99
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 185
BseMI GCAATG 1 cut(s) 99
BseNI ACTGG 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 185
Bsp143I GATC 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 112
BspPI GGATC 1 cut(s) 196
BsrDI GCAATG 1 cut(s) 99
BsrI ACTGG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 23
BssMI GATC 1 cut(s) 188
Bst2UI CCWGG 1 cut(s) 24
Bst4CI ACNGT 2 cut(s) 14, 91
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 191
BstMBI GATC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 22
Cfr13I GGNCC 2 cut(s) 111, 176
CviAII CATG 1 cut(s) 173
CviJI RGCY 2 cut(s) 121, 146
CviKI_1 RGCY 2 cut(s) 121, 146
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 190
DpnII GATC 1 cut(s) 188
Eco47I GGWCC 2 cut(s) 111, 176
EcoRII CCWGG 1 cut(s) 22
FaeI CATG 1 cut(s) 176
FaiI YATR 2 cut(s) 18, 174
FatI CATG 1 cut(s) 172
Hin1II CATG 1 cut(s) 176
HinfI GANTC 2 cut(s) 31, 55
Hpy166II GTNNAC 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 158
HpyCH4III ACNGT 2 cut(s) 14, 91
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 188
LpnPI CCDG 6 cut(s) 9, 18, 36, 128, 171, 192
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 190
MboI GATC 1 cut(s) 188
MluCI AATT 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
NdeII GATC 1 cut(s) 188
NlaIII CATG 1 cut(s) 176
NlaIV GGNNCC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 85
PfeI GAWTC 2 cut(s) 31, 55
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 112
PspPI GGNCC 2 cut(s) 111, 176
Sau3AI GATC 1 cut(s) 188
Sau96I GGNCC 2 cut(s) 111, 176
ScrFI CCNGG 1 cut(s) 24
SetI ASST 1 cut(s) 85
SinI GGWCC 2 cut(s) 111, 176
Sse9I AATT 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 22
TaaI ACNGT 2 cut(s) 14, 91
TasI AATT 1 cut(s) 137
TfiI GAWTC 2 cut(s) 31, 55
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 88
VpaK11BI GGWCC 2 cut(s) 111, 176
XapI RAATTY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.