Rh4AG038100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0018092
Physical Location & Seq
Reverse (-)
8106084 .. 8107827
1744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG038100.1

Sequence Viewer

Length: 231 bp
ATGGACAAAAGCGAACAGTCACCGTTAGAAGATTTATTGTCAAGAACTAGGGTTCGAGACTGCAATCGGAATTCTCGAGCAGAATCCGGCGATATCGGACTCGGTCATCGGCGCTCCTGGGTTCTCGAAGGCATCGAAGATTTTCTGGTCGCGGTTGAGGACGACTGCTGTTTGTTCTACAAAACGGAGCTGAGCTCCTTACTGAATCTGGTCCTCGGGTCCGGCGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.47

Weight (kDa)

4.67

Isoelectric Point (pI)

71.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018092)

Species Orthologous Gene IDs
malus_domestica MD13G1210300.v1.1
prunus_persica Prupe.3G302100_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0391461 RchiOBHm_Chr4g0391621
rosa_laevigata RLG00000021517
rosa_multiflora Rmu_sc0001174.1_g000015
rosa_roxburghii Rroxscaffold_3G00220420
rosa_samantha Rh2AG655400 Rh2BG627100 Rh2BG666600 Rh4AG038100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 152
AciI CCGC 2 cut(s) 152, 225
AcsI RAATTY 1 cut(s) 70
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 2 cut(s) 190, 195
AluI AGCT 2 cut(s) 190, 195
Alw21I GWGCWC 1 cut(s) 197
Alw26I GTCTC 1 cut(s) 51
Ama87I CYCGRG 2 cut(s) 75, 215
ApoI RAATTY 1 cut(s) 70
Asp700I GAANNNNTTC 1 cut(s) 141
AspLEI GCGC 1 cut(s) 114
AspS9I GGNCC 2 cut(s) 211, 219
AsuHPI GGTGA 1 cut(s) 12
AvaI CYCGRG 2 cut(s) 75, 215
AvaII GGWCC 2 cut(s) 211, 219
BanII GRGCYC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 51
BfaI CTAG 2 cut(s) 48, 229
BfoI RGCGCY 1 cut(s) 115
BisI GCNGC 1 cut(s) 226
BlpI GCTNAGC 1 cut(s) 191
BlsI GCNGC 1 cut(s) 227
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 2 cut(s) 211, 219
BmeT110I CYCGRG 2 cut(s) 75, 215
BmgT120I GGNCC 2 cut(s) 211, 219
BmiI GGNNCC 1 cut(s) 220
BmrFI CCNGG 1 cut(s) 118
BmsI GCATC 1 cut(s) 141
BplI GAGNNNNNCTC 2 cut(s) 179, 211
Bpu1102I GCTNAGC 1 cut(s) 191
BsaJI CCNNGG 2 cut(s) 117, 214
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 2 cut(s) 117, 214
BseMII CTCAG 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 152
BsiHKAI GWGCWC 1 cut(s) 197
BsiHKCI CYCGRG 2 cut(s) 75, 215
BsiSI CCGG 2 cut(s) 87, 222
BsmAI GTCTC 1 cut(s) 51
BsoBI CYCGRG 2 cut(s) 75, 215
Bsp1286I GDGCHC 1 cut(s) 197
Bsp1720I GCTNAGC 1 cut(s) 191
BspACI CCGC 2 cut(s) 152, 225
BspCNI CTCAG 1 cut(s) 183
BspFNI CGCG 1 cut(s) 152
BspLI GGNNCC 1 cut(s) 220
BssECI CCNNGG 2 cut(s) 117, 214
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 2 cut(s) 18, 24
BstDEI CTNAG 1 cut(s) 191
BstFNI CGCG 1 cut(s) 152
BstH2I RGCGCY 1 cut(s) 115
BstHHI GCGC 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 51
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
BstUI CGCG 1 cut(s) 152
CfoI GCGC 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 211, 219
CviJI RGCY 3 cut(s) 190, 195, 228
CviKI_1 RGCY 3 cut(s) 190, 195, 228
DdeI CTNAG 1 cut(s) 191
Ecl136II GAGCTC 1 cut(s) 195
Eco24I GRGCYC 1 cut(s) 197
Eco32I GATATC 1 cut(s) 94
Eco47I GGWCC 2 cut(s) 211, 219
Eco53kI GAGCTC 1 cut(s) 195
Eco88I CYCGRG 2 cut(s) 75, 215
EcoICRI GAGCTC 1 cut(s) 195
EcoRI GAATTC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 116
EcoRV GATATC 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 197
Fnu4HI GCNGC 1 cut(s) 226
FriOI GRGCYC 1 cut(s) 197
Fsp4HI GCNGC 1 cut(s) 226
FspBI CTAG 2 cut(s) 48, 229
GlaI GCGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 226
HaeII RGCGCY 1 cut(s) 115
HapII CCGG 2 cut(s) 87, 222
HhaI GCGC 1 cut(s) 114
Hin6I GCGC 1 cut(s) 112
HinP1I GCGC 1 cut(s) 112
HinfI GANTC 3 cut(s) 83, 99, 205
HpaII CCGG 2 cut(s) 87, 222
HphI GGTGA 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 69, 98
Hpy188III TCNNGA 4 cut(s) 42, 56, 75, 125
HpyAV CCTTC 1 cut(s) 122
HpyCH4III ACNGT 2 cut(s) 18, 24
HpyCH4V TGCA 1 cut(s) 63
HpyF3I CTNAG 1 cut(s) 191
HspAI GCGC 1 cut(s) 112
LmnI GCTCC 3 cut(s) 119, 187, 200
LpnPI CCDG 5 cut(s) 100, 103, 130, 131, 194
LweI GCATC 1 cut(s) 141
MaeI CTAG 2 cut(s) 48, 229
MaeIII GTNAC 1 cut(s) 18
MboII GAAGA 2 cut(s) 41, 149
MhlI GDGCHC 1 cut(s) 197
MluCI AATT 1 cut(s) 70
MlyI GAGTC 1 cut(s) 93
MnlI CCTC 2 cut(s) 151, 224
MroXI GAANNNNTTC 1 cut(s) 141
MspI CCGG 2 cut(s) 87, 222
MspR9I CCNGG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 118
MvnI CGCG 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 220
NmuCI GTSAC 1 cut(s) 18
PaeR7I CTCGAG 1 cut(s) 75
PcsI WCGNNNNNNNCGW 2 cut(s) 73, 132
PdmI GAANNNNTTC 1 cut(s) 141
PfeI GAWTC 2 cut(s) 83, 205
PflFI GACNNNGTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 227
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
Psp124BI GAGCTC 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 220
PspPI GGNCC 2 cut(s) 211, 219
PsyI GACNNNGTC 1 cut(s) 102
SacI GAGCTC 1 cut(s) 197
SatI GCNGC 1 cut(s) 226
Sau96I GGNCC 2 cut(s) 211, 219
SchI GAGTC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 118
SduI GDGCHC 1 cut(s) 197
SetI ASST 2 cut(s) 192, 197
SfaNI GCATC 1 cut(s) 141
Sfr274I CTCGAG 1 cut(s) 75
SinI GGWCC 2 cut(s) 211, 219
SlaI CTCGAG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 1 cut(s) 70
SsiI CCGC 2 cut(s) 152, 225
SspMI CTAG 2 cut(s) 48, 229
SstI GAGCTC 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 18, 24
TaqI TCGA 4 cut(s) 55, 76, 126, 135
TaqII GACCGA 1 cut(s) 92
TasI AATT 1 cut(s) 70
TauI GCSGC 1 cut(s) 228
TfiI GAWTC 2 cut(s) 83, 205
TseFI GTSAC 1 cut(s) 18
Tsp45I GTSAC 1 cut(s) 18
TspGWI ACGGA 1 cut(s) 200
Tth111I GACNNNGTC 1 cut(s) 102
VpaK11BI GGWCC 2 cut(s) 211, 219
XapI RAATTY 1 cut(s) 70
XhoI CTCGAG 1 cut(s) 75
XmnI GAANNNNTTC 1 cut(s) 141
XspI CTAG 2 cut(s) 48, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.