Rh4BG023500

tRNA-splicing endonuclease subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
3704763 .. 3706184
1422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG023500.1

Sequence Viewer

Length: 471 bp
ATGGCAGAGGATGAAGTGATGAGGAGGTGGGCTTTTGCTACTCTAATTTGTAACATTAGAGAGCACTTGATTGTAGCTGAAAAATTAACGATTATGAATGAAGAATGTTTAGATGAAGAATATATCAATGACTATGATGAAGAAGAAGAGGAAAACCACTATGCATCTCGTGCCATATCCAAGATGCAACCCAGGAGGTCTAGTGTATCCAAGGCTTACTGGGATGATGAGATGGGCATGGCTGTCATATTTCCAAAGGGTAGAATTTGGAGGACCATGGGAATCTCTCGTAATGGCAAGCTCTATATCTCCATTGAGGAAGTTTTGTATTTGGTTGAAATAGGGGCTTTGCTTCTCTTGGATGGTAGTGATACTAGTATTTCCTTGGAAGATATATATACAAAGGTTTCAGATGGAAAGAATAAGTTAATGATACTTGACCTTTTGGTTACTTGTTTGGTAGCAATATAG

Protein Analysis

156

Amino Acids

17.98

Weight (kDa)

4.59

Isoelectric Point (pI)

60.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA_int_end_N2 PF12928 65 - 119 7.1e-15 tRNA-splicing endonuclease subunit sen54 N-term
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 264
AgsI TTSAA 1 cut(s) 338
AhlI ACTAGT 1 cut(s) 374
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 2 cut(s) 77, 301
AluI AGCT 2 cut(s) 77, 301
Alw21I GWGCWC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 264
AspS9I GGNCC 1 cut(s) 273
AvaII GGWCC 1 cut(s) 273
BauI CACGAG 1 cut(s) 168
Bbv12I GWGCWC 1 cut(s) 66
BccI CCATC 3 cut(s) 226, 356, 407
BciT130I CCWGG 1 cut(s) 193
BciVI GTATCC 1 cut(s) 217
BcuI ACTAGT 1 cut(s) 374
BfaI CTAG 2 cut(s) 201, 375
BfuI GTATCC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 273
BmgT120I GGNCC 1 cut(s) 273
BmrFI CCNGG 1 cut(s) 193
BmrI ACTGGG 1 cut(s) 229
BmsI GCATC 2 cut(s) 173, 174
BmuI ACTGGG 1 cut(s) 229
BsaJI CCNNGG 4 cut(s) 191, 210, 276, 384
BsaXI ACNNNNNCTCC 2 cut(s) 187, 217
Bse1I ACTGG 1 cut(s) 224
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 4 cut(s) 191, 210, 276, 384
BseGI GGATG 3 cut(s) 16, 229, 367
BseNI ACTGG 1 cut(s) 224
BseRI GAGGAG 1 cut(s) 37
BsiHKAI GWGCWC 1 cut(s) 66
Bsp1286I GDGCHC 1 cut(s) 66
Bsp19I CCATGG 1 cut(s) 276
BsrI ACTGG 1 cut(s) 224
BssECI CCNNGG 4 cut(s) 191, 210, 276, 384
BssSI CACGAG 1 cut(s) 168
BssT1I CCWWGG 3 cut(s) 210, 276, 384
Bst2BI CACGAG 1 cut(s) 168
Bst2UI CCWGG 1 cut(s) 193
Bst6I CTCTTC 1 cut(s) 141
BstAPI GCANNNNNTGC 1 cut(s) 170
BstC8I GCNNGC 1 cut(s) 299
BstDSI CCRYGG 1 cut(s) 276
BstF5I GGATG 3 cut(s) 16, 229, 367
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BsuI GTATCC 1 cut(s) 217
BtgI CCRYGG 1 cut(s) 276
BtsCI GGATG 3 cut(s) 16, 229, 367
Cac8I GCNNGC 1 cut(s) 299
Cfr13I GGNCC 1 cut(s) 273
CviAII CATG 2 cut(s) 238, 277
CviJI RGCY 6 cut(s) 32, 77, 215, 242, 301, 347
CviKI_1 RGCY 6 cut(s) 32, 77, 215, 242, 301, 347
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco130I CCWWGG 3 cut(s) 210, 276, 384
Eco47I GGWCC 1 cut(s) 273
EcoRII CCWGG 1 cut(s) 191
EcoT14I CCWWGG 3 cut(s) 210, 276, 384
EcoT22I ATGCAT 1 cut(s) 166
ErhI CCWWGG 3 cut(s) 210, 276, 384
FaeI CATG 2 cut(s) 241, 280
FatI CATG 2 cut(s) 237, 276
FokI GGATG 3 cut(s) 23, 236, 374
FspBI CTAG 2 cut(s) 201, 375
Hin1II CATG 2 cut(s) 241, 280
HinfI GANTC 1 cut(s) 282
Hpy188I TCNGA 1 cut(s) 412
HpyCH4V TGCA 2 cut(s) 164, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
Hsp92II CATG 2 cut(s) 241, 280
LpnPI CCDG 3 cut(s) 178, 205, 205
LweI GCATC 2 cut(s) 173, 174
MaeI CTAG 2 cut(s) 201, 375
MaeIII GTNAC 2 cut(s) 50, 448
MboII GAAGA 6 cut(s) 113, 128, 152, 155, 158, 401
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 3 cut(s) 45, 83, 264
MnlI CCTC 6 cut(s) 15, 18, 142, 189, 264, 310
Mph1103I ATGCAT 1 cut(s) 166
MseI TTAA 2 cut(s) 86, 428
MspR9I CCNGG 1 cut(s) 193
MvaI CCWGG 1 cut(s) 193
MwoI GCNNNNNNNGC 1 cut(s) 170
NcoI CCATGG 1 cut(s) 276
NlaIII CATG 2 cut(s) 241, 280
NsiI ATGCAT 1 cut(s) 166
PfeI GAWTC 1 cut(s) 282
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspPI GGNCC 1 cut(s) 273
SaqAI TTAA 2 cut(s) 86, 428
Sau96I GGNCC 1 cut(s) 273
ScrFI CCNGG 1 cut(s) 193
SduI GDGCHC 1 cut(s) 66
SetI ASST 6 cut(s) 29, 79, 200, 303, 408, 444
SfaNI GCATC 2 cut(s) 173, 174
SinI GGWCC 1 cut(s) 273
SpeI ACTAGT 1 cut(s) 374
Sse9I AATT 3 cut(s) 45, 83, 264
SspMI CTAG 2 cut(s) 201, 375
StyD4I CCNGG 1 cut(s) 191
StyI CCWWGG 3 cut(s) 210, 276, 384
TasI AATT 3 cut(s) 45, 83, 264
TfiI GAWTC 1 cut(s) 282
Tru1I TTAA 2 cut(s) 86, 428
Tru9I TTAA 2 cut(s) 86, 428
TspDTI ATGAA 5 cut(s) 27, 110, 114, 129, 153
VpaK11BI GGWCC 1 cut(s) 273
XapI RAATTY 1 cut(s) 264
XspI CTAG 2 cut(s) 201, 375
Zsp2I ATGCAT 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.