Rh4CG312600

receptor kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0016827
Physical Location & Seq
Forward (+)
57493371 .. 57497793
4423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG312600.1

Sequence Viewer

Length: 387 bp
ATGGTTTCTCGAGTTCTGCTTTGTTTTCTGTTTGCAGTTGCCACTGCATCTGTGGATTGTAACTTGGAAGGGGATATTCTTTATTCCTGGAAAACCATGTTGGTCGACCCTAACAATGTTCTTGCTAGCTGGAACCTGACATCCCCCAATCCATGCTCTTGGTTCCATGTTACCTGCAATAACGAAAACATCGTTACAAGGCTGGACCTTGGCAATGCTGGATTATCAGGACCTATTATCCCTGCGCTTGCAAATTTGACTAACCTCCAATACTTAAAGAAGTATGGTTTTGGCTCCGACAGAGTTCAAATGATATGTCTGGATTTTCCTCTCTGTTTTCAAGAAATACTGGCATGCACGCAAACCTCTACTCTATCTCTTGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04016 ko04075 ko04626 map04016 map04075 map04626
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8

Protein Analysis

128

Amino Acids

14.11

Weight (kDa)

4.75

Isoelectric Point (pI)

27.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRRNT_2 PF08263 21 - 60 2.1e-11 Leucine rich repeat N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016827)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g23091 FvH4_4g23092 FvH4_4g23092
malus_domestica MD13G1125600.v1.1
pyrus_communis pycom13g10960
rosa_chinensis RchiOBHm_Chr4g0429381
rosa_laevigata RLG00000007075
rosa_multiflora Rmu_sc0003708.1_g000022
rosa_roxburghii Rroxscaffold_5G00371020
rosa_rugosa Rorug04G0235400
rosa_samantha Rh4AG291300 Rh4CG312600 Rh4DG294100
rosa_wichuraiana Rw4G025220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 182
AccI GTMKAC 1 cut(s) 105
AcsI RAATTY 1 cut(s) 253
AgsI TTSAA 2 cut(s) 308, 341
AjnI CCWGG 1 cut(s) 86
AjuI GAANNNNNNNTTGG 2 cut(s) 83, 115
AloI GAACNNNNNNTCC 2 cut(s) 125, 157
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Ama87I CYCGRG 1 cut(s) 9
ApoI RAATTY 1 cut(s) 253
ArsI GACNNNNNNTTYG 2 cut(s) 301, 333
AspLEI GCGC 1 cut(s) 247
AspS9I GGNCC 2 cut(s) 205, 230
AsuNHI GCTAGC 1 cut(s) 125
AvaI CYCGRG 1 cut(s) 9
AvaII GGWCC 2 cut(s) 205, 230
BciT130I CCWGG 1 cut(s) 88
BfaI CTAG 1 cut(s) 126
BfuAI ACCTGC 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 88
Bme18I GGWCC 2 cut(s) 205, 230
BmeT110I CYCGRG 1 cut(s) 9
BmgT120I GGNCC 2 cut(s) 205, 230
BmiI GGNNCC 3 cut(s) 134, 164, 295
BmrFI CCNGG 1 cut(s) 88
BmsI GCATC 1 cut(s) 56
BmtI GCTAGC 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 208
Bse1I ACTGG 1 cut(s) 354
Bse3DI GCAATG 1 cut(s) 220
BseBI CCWGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 208
BseGI GGATG 1 cut(s) 140
BseMI GCAATG 1 cut(s) 220
BseNI ACTGG 1 cut(s) 354
BsiHKCI CYCGRG 1 cut(s) 9
BsoBI CYCGRG 1 cut(s) 9
BspLI GGNNCC 3 cut(s) 134, 164, 295
BspMI ACCTGC 1 cut(s) 182
BspOI GCTAGC 1 cut(s) 129
BsrDI GCAATG 1 cut(s) 220
BsrI ACTGG 1 cut(s) 354
BssECI CCNNGG 1 cut(s) 208
BssT1I CCWWGG 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 88
BstC8I GCNNGC 4 cut(s) 127, 249, 355, 359
BstF5I GGATG 1 cut(s) 140
BstHHI GCGC 1 cut(s) 247
BstNI CCWGG 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 357
BstSCI CCNGG 1 cut(s) 86
BstXI CCANNNNNNTGG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 140
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 42
BveI ACCTGC 1 cut(s) 182
Cac8I GCNNGC 4 cut(s) 127, 249, 355, 359
CfoI GCGC 1 cut(s) 247
Cfr13I GGNCC 2 cut(s) 205, 230
CviAII CATG 4 cut(s) 97, 153, 167, 354
CviJI RGCY 3 cut(s) 129, 202, 294
CviKI_1 RGCY 3 cut(s) 129, 202, 294
Eco130I CCWWGG 1 cut(s) 208
Eco47I GGWCC 2 cut(s) 205, 230
Eco88I CYCGRG 1 cut(s) 9
EcoO109I RGGNCCY 1 cut(s) 230
EcoRII CCWGG 1 cut(s) 86
EcoT14I CCWWGG 1 cut(s) 208
ErhI CCWWGG 1 cut(s) 208
FaeI CATG 4 cut(s) 100, 156, 170, 357
FaiI YATR 6 cut(s) 98, 154, 168, 285, 316, 355
FatI CATG 4 cut(s) 96, 152, 166, 353
FblI GTMKAC 1 cut(s) 105
FokI GGATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 126
GlaI GCGC 1 cut(s) 246
HhaI GCGC 1 cut(s) 247
Hin1II CATG 4 cut(s) 100, 156, 170, 357
Hin6I GCGC 1 cut(s) 245
HinP1I GCGC 1 cut(s) 245
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 298
Hpy188III TCNNGA 4 cut(s) 9, 228, 320, 341
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 5 cut(s) 35, 47, 177, 251, 357
Hsp92II CATG 4 cut(s) 100, 156, 170, 357
HspAI GCGC 1 cut(s) 245
LmnI GCTCC 1 cut(s) 299
LweI GCATC 1 cut(s) 56
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 3 cut(s) 59, 169, 193
MluCI AATT 1 cut(s) 253
MmeI TCCRAC 1 cut(s) 321
MnlI CCTC 3 cut(s) 275, 339, 376
MseI TTAA 1 cut(s) 275
MspR9I CCNGG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 88
NheI GCTAGC 1 cut(s) 125
NlaIII CATG 4 cut(s) 100, 156, 170, 357
NlaIV GGNNCC 3 cut(s) 134, 164, 295
NspI RCATGY 1 cut(s) 357
PaeI GCATGC 1 cut(s) 357
PaeR7I CTCGAG 1 cut(s) 9
PcsI WCGNNNNNNNCGW 1 cut(s) 189
PfoI TCCNGGA 1 cut(s) 86
PpuMI RGGWCCY 1 cut(s) 230
Psp5II RGGWCCY 1 cut(s) 230
Psp6I CCWGG 1 cut(s) 86
PspGI CCWGG 1 cut(s) 86
PspN4I GGNNCC 3 cut(s) 134, 164, 295
PspPI GGNCC 2 cut(s) 205, 230
PspPPI RGGWCCY 1 cut(s) 230
SalI GTCGAC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 275
Sau96I GGNCC 2 cut(s) 205, 230
ScrFI CCNGG 1 cut(s) 88
SetI ASST 7 cut(s) 131, 138, 176, 210, 235, 267, 368
SfaNI GCATC 1 cut(s) 56
Sfr274I CTCGAG 1 cut(s) 9
SinI GGWCC 2 cut(s) 205, 230
SlaI CTCGAG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 9
SmoI CTYRAG 1 cut(s) 9
SphI GCATGC 1 cut(s) 357
Sse9I AATT 1 cut(s) 253
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 86
StyI CCWWGG 1 cut(s) 208
TaqI TCGA 2 cut(s) 10, 105
TasI AATT 1 cut(s) 253
Tru1I TTAA 1 cut(s) 275
Tru9I TTAA 1 cut(s) 275
TscAI CASTG 1 cut(s) 49
TspRI CASTG 1 cut(s) 49
VpaK11BI GGWCC 2 cut(s) 205, 230
XapI RAATTY 1 cut(s) 253
XceI RCATGY 1 cut(s) 357
XcmI CCANNNNNNNNNTGG 1 cut(s) 49
XhoI CTCGAG 1 cut(s) 9
XmiI GTMKAC 1 cut(s) 105
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.