Rh4CG424600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
66767563 .. 66768306
744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG424600.1

Sequence Viewer

Length: 237 bp
ATGCAAGTAAAAGTTGAGGATCGAAGTTGCCTTGTTTCTCTGAACAATTTGAGGCCAGTTGCTTGCTTTTCCTATTCAAGTGATGTTAGGGAAAGGGATGACAGCCTTGTAATTAAGGATTTAAATCCAAGCCAGAAGTTTTTGAGGTTTGAGCCTTTTGTTCGCGAGGAGCAAGATACTGCTGGAAAATATGATGATGTTTACCATTCTGTAAGCCTCTTGGCTGTTGATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

9.0

Weight (kDa)

4.78

Isoelectric Point (pI)

56.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 165
AclWI GGATC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 78
AlwI GGATC 1 cut(s) 27
AoxI GGCC 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 56
Bse8I GATNNNNATC 1 cut(s) 123
BseGI GGATG 1 cut(s) 103
BseJI GATNNNNATC 1 cut(s) 123
BseNI ACTGG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 165
BshFI GGCC 1 cut(s) 55
BsnI GGCC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 19
Bsp68I TCGCGA 1 cut(s) 165
BspANI GGCC 1 cut(s) 55
BspFNI CGCG 1 cut(s) 165
BspPI GGATC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 56
BssMI GATC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 64
BstF5I GGATG 1 cut(s) 103
BstFNI CGCG 1 cut(s) 165
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstUI CGCG 1 cut(s) 165
BsuRI GGCC 1 cut(s) 55
BtsCI GGATG 1 cut(s) 103
BtuMI TCGCGA 1 cut(s) 165
Cac8I GCNNGC 1 cut(s) 64
CviJI RGCY 6 cut(s) 55, 105, 132, 154, 216, 224
CviKI_1 RGCY 6 cut(s) 55, 105, 132, 154, 216, 224
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
DraI TTTAAA 1 cut(s) 123
FaiI YATR 1 cut(s) 192
FokI GGATG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 202
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 3 cut(s) 69, 146, 168
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MluCI AATT 3 cut(s) 46, 111, 232
MnlI CCTC 5 cut(s) 10, 45, 138, 160, 227
MseI TTAA 2 cut(s) 114, 122
MvnI CGCG 1 cut(s) 165
NdeII GATC 1 cut(s) 19
NruI TCGCGA 1 cut(s) 165
RruI TCGCGA 1 cut(s) 165
SaqAI TTAA 2 cut(s) 114, 122
Sau3AI GATC 1 cut(s) 19
SetI ASST 1 cut(s) 149
SmiI ATTTAAAT 1 cut(s) 123
Sse9I AATT 3 cut(s) 46, 111, 232
SwaI ATTTAAAT 1 cut(s) 123
TaqI TCGA 1 cut(s) 22
TasI AATT 3 cut(s) 46, 111, 232
Tru1I TTAA 2 cut(s) 114, 122
Tru9I TTAA 2 cut(s) 114, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.