Rh5AG143600

Citrate synthase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
15073659 .. 15092724
19066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG143600.1

Sequence Viewer

Length: 201 bp
ATGGAGATTGATTTGCAGTTGCAAAGGCGAAAGCTGTATCCAAATGTTGATTTCTACTCTGGTTCAGATATAGAGCAATCGGATTTCCAATGGAGTTCTTCCCAGTTTTGTTTGCAATCCCTCGAATGGCTGGTTACATGGCACACTGGAGAATCCCTGGGTGATTCTGATACTAAGATCATGAGGTCTGCACAGCTGTAA

Protein Analysis

66

Amino Acids

7.75

Weight (kDa)

4.41

Isoelectric Point (pI)

74.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018571)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 126
AjnI CCWGG 1 cut(s) 156
AluBI AGCT 2 cut(s) 34, 196
AluI AGCT 2 cut(s) 34, 196
AsuHPI GGTGA 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 158
BciVI GTATCC 1 cut(s) 48
BfuI GTATCC 1 cut(s) 48
Bme1390I CCNGG 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 158
BmrI ACTGGG 1 cut(s) 97
BmuI ACTGGG 1 cut(s) 97
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 156, 157
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse1I ACTGG 2 cut(s) 103, 151
BseBI CCWGG 1 cut(s) 158
BseDI CCNNGG 2 cut(s) 156, 157
BseLI CCNNNNNNNGG 1 cut(s) 126
BseNI ACTGG 2 cut(s) 103, 151
BsgI GTGCAG 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 126
Bsp143I GATC 1 cut(s) 177
BspHI TCATGA 1 cut(s) 180
BsrI ACTGG 2 cut(s) 103, 151
BssECI CCNNGG 2 cut(s) 156, 157
BssMI GATC 1 cut(s) 177
Bst2UI CCWGG 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstNI CCWGG 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 156
BsuI GTATCC 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 144
CciI TCATGA 1 cut(s) 180
CviAII CATG 2 cut(s) 138, 181
CviJI RGCY 3 cut(s) 34, 130, 196
CviKI_1 RGCY 3 cut(s) 34, 130, 196
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 156
FaeI CATG 2 cut(s) 141, 184
FaiI YATR 3 cut(s) 71, 139, 182
FatI CATG 2 cut(s) 137, 180
GsuI CTGGAG 1 cut(s) 168
Hin1II CATG 2 cut(s) 141, 184
HinfI GANTC 2 cut(s) 152, 164
HphI GGTGA 1 cut(s) 173
Hpy188I TCNGA 3 cut(s) 67, 82, 169
Hpy188III TCNNGA 1 cut(s) 181
HpyCH4V TGCA 4 cut(s) 16, 22, 115, 191
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 2 cut(s) 141, 184
Kzo9I GATC 1 cut(s) 177
LpnPI CCDG 6 cut(s) 45, 116, 116, 132, 143, 170
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MboII GAAGA 1 cut(s) 90
MnlI CCTC 2 cut(s) 131, 177
MspA1I CMGCKG 1 cut(s) 196
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
NdeII GATC 1 cut(s) 177
NlaIII CATG 2 cut(s) 141, 184
PagI TCATGA 1 cut(s) 180
PasI CCCWGGG 1 cut(s) 157
PfeI GAWTC 2 cut(s) 152, 164
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
PvuII CAGCTG 1 cut(s) 196
Sau3AI GATC 1 cut(s) 177
ScrFI CCNGG 1 cut(s) 158
SetI ASST 3 cut(s) 36, 188, 198
SgeI CNNG 9 cut(s) 72, 115, 134, 143, 150, 159, 169, 170, 193
StyD4I CCNGG 1 cut(s) 156
TaqI TCGA 1 cut(s) 123
TfiI GAWTC 2 cut(s) 152, 164
TscAI CASTG 1 cut(s) 151
TspRI CASTG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.