Rh5BG184100

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0015978
Physical Location & Seq
Reverse (-)
20244755 .. 20245825
1071 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG184100.1

Sequence Viewer

Length: 411 bp
ATGAAGAAGATCAGTTTGCTATTAAGGAAGTGCAAGAGCTTGTCAAGCCAGCTAGGGAGATCTTCATCGTATACCAGTCTACGGTCCAAATCGACTAGAGAAGATTTGTATGATGGCAACATCATGAATGAGAATCATCAGCAAACTACTACTATATTTGTTGGAAGCACCAGAAAGCGTTACGTGATCAGCTCCAAGTACCTGAAGCATCCTTTGTTGAATGCTTTGATCGAGAAGTCATCGAATAAGCGAAATAACAATCGAGGAGATGATCATGATCATGAGGATATCTTGGTGAAGTGTGAGGTGGTTCTCTTTGATCACTTGTTATGGATGCTGGAAAATGGAGATCCAAGCTTTGGTGGTACTTCAGAGTCTTTGGAGGAACTAGCTGCACTCTATGAGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

136

Amino Acids

15.58

Weight (kDa)

7.8

Isoelectric Point (pI)

53.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 40 - 113 7.2e-14 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015978)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G12955
fragaria_vesca FvH4_3g15820
malus_domestica MD05G1219800.v1.1 MD10G1202100.v1.1
prunus_persica Prupe.4G140200_v2.0.a1
pyrus_communis pycom05g20110 pycom10g17290
rosa_chinensis RchiOBHm_Chr5g0026611
rosa_multiflora Rmu_sc0018952.1_g000005
rosa_rugosa Rorug05G0094200
rosa_samantha Rh5AG187600 Rh5BG184100 Rh5CG204100 Rh5DG186400
rosa_wichuraiana Rw5G016990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 359
AccI GTMKAC 2 cut(s) 71, 79
AclWI GGATC 1 cut(s) 344
AcuI CTGAAG 2 cut(s) 224, 354
AfaI GTAC 2 cut(s) 200, 367
AfiI CCNNNNNNNGG 2 cut(s) 81, 359
AgsI TTSAA 1 cut(s) 220
AluBI AGCT 5 cut(s) 39, 52, 192, 357, 392
AluI AGCT 5 cut(s) 39, 52, 192, 357, 392
AlwI GGATC 1 cut(s) 344
ApeKI GCWGC 1 cut(s) 392
AspS9I GGNCC 1 cut(s) 84
AsuHPI GGTGA 1 cut(s) 307
AvaII GGWCC 1 cut(s) 84
BbvI GCAGC 1 cut(s) 379
BccI CCATC 1 cut(s) 107
BclI TGATCA 4 cut(s) 186, 271, 277, 319
BfaI CTAG 3 cut(s) 53, 96, 389
BglII AGATCT 1 cut(s) 59
BisI GCNGC 1 cut(s) 393
BlsI GCNGC 1 cut(s) 394
Bme18I GGWCC 1 cut(s) 84
BmgT120I GGNCC 1 cut(s) 84
BmsI GCATC 2 cut(s) 217, 324
BsaAI YACGTR 1 cut(s) 184
BsaBI GATNNNNATC 2 cut(s) 64, 276
Bsc4I CCNNNNNNNGG 2 cut(s) 81, 359
Bse1I ACTGG 1 cut(s) 75
Bse8I GATNNNNATC 2 cut(s) 64, 276
BseGI GGATG 2 cut(s) 208, 339
BseJI GATNNNNATC 2 cut(s) 64, 276
BseLI CCNNNNNNNGG 2 cut(s) 81, 359
BseNI ACTGG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 279
BseXI GCAGC 1 cut(s) 379
BsgI GTGCAG 1 cut(s) 378
BslI CCNNNNNNNGG 2 cut(s) 81, 359
BsmI GAATGC 1 cut(s) 226
Bsp143I GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
BspHI TCATGA 3 cut(s) 123, 274, 280
BspPI GGATC 1 cut(s) 344
BsrI ACTGG 1 cut(s) 75
BssMI GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
BssNAI GTATAC 1 cut(s) 72
Bst1107I GTATAC 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 84
BstBAI YACGTR 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 50
BstF5I GGATG 2 cut(s) 208, 339
BstKTI GATC 8 cut(s) 12, 62, 189, 231, 274, 280, 322, 352
BstMBI GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 379
BstX2I RGATCY 2 cut(s) 59, 349
BstYI RGATCY 2 cut(s) 59, 349
BstZ17I GTATAC 1 cut(s) 72
BtsCI GGATG 2 cut(s) 208, 339
Cac8I GCNNGC 1 cut(s) 50
CciI TCATGA 3 cut(s) 123, 274, 280
Cfr13I GGNCC 1 cut(s) 84
Csp6I GTAC 2 cut(s) 199, 366
CviAII CATG 3 cut(s) 124, 275, 281
CviJI RGCY 6 cut(s) 39, 48, 52, 192, 357, 392
CviKI_1 RGCY 6 cut(s) 39, 48, 52, 192, 357, 392
CviQI GTAC 2 cut(s) 199, 366
DpnI GATC 8 cut(s) 11, 61, 188, 230, 273, 279, 321, 351
DpnII GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
Eco32I GATATC 1 cut(s) 289
Eco47I GGWCC 1 cut(s) 84
Eco57I CTGAAG 2 cut(s) 224, 354
EcoRV GATATC 1 cut(s) 289
FaeI CATG 3 cut(s) 127, 278, 284
FaiI YATR 8 cut(s) 72, 111, 125, 155, 276, 282, 331, 402
FatI CATG 3 cut(s) 123, 274, 280
FbaI TGATCA 4 cut(s) 186, 271, 277, 319
FblI GTMKAC 2 cut(s) 71, 79
Fnu4HI GCNGC 1 cut(s) 393
FokI GGATG 2 cut(s) 195, 346
Fsp4HI GCNGC 1 cut(s) 393
FspBI CTAG 3 cut(s) 53, 96, 389
GluI GCNGC 1 cut(s) 393
Hin1II CATG 3 cut(s) 127, 278, 284
HindIII AAGCTT 1 cut(s) 355
HinfI GANTC 2 cut(s) 133, 374
HphI GGTGA 1 cut(s) 307
Hpy166II GTNNAC 2 cut(s) 72, 80
Hpy188I TCNGA 1 cut(s) 373
Hpy188III TCNNGA 4 cut(s) 124, 232, 275, 281
Hpy8I GTNNAC 2 cut(s) 72, 80
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4IV ACGT 1 cut(s) 183
HpyCH4V TGCA 2 cut(s) 33, 395
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 183
Hsp92II CATG 3 cut(s) 127, 278, 284
Ksp22I TGATCA 4 cut(s) 186, 271, 277, 319
Kzo9I GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
LmnI GCTCC 1 cut(s) 197
LpnPI CCDG 5 cut(s) 62, 88, 184, 215, 323
Lsp1109I GCAGC 1 cut(s) 379
LweI GCATC 2 cut(s) 217, 324
MaeI CTAG 3 cut(s) 53, 96, 389
MaeII ACGT 1 cut(s) 183
MaeIII GTNAC 1 cut(s) 179
MalI GATC 8 cut(s) 11, 61, 188, 230, 273, 279, 321, 351
MboI GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
MboII GAAGA 4 cut(s) 16, 19, 54, 113
MflI RGATCY 2 cut(s) 59, 349
MlyI GAGTC 1 cut(s) 383
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 4 cut(s) 257, 277, 298, 376
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 279
Mva1269I GAATGC 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
NlaIII CATG 3 cut(s) 127, 278, 284
PagI TCATGA 3 cut(s) 123, 274, 280
PctI GAATGC 1 cut(s) 226
PfeI GAWTC 1 cut(s) 133
PflMI CCANNNNNTGG 1 cut(s) 359
PkrI GCNGC 1 cut(s) 394
PleI GAGTC 1 cut(s) 382
PpsI GAGTC 1 cut(s) 382
Ppu21I YACGTR 1 cut(s) 184
PspPI GGNCC 1 cut(s) 84
PsuI RGATCY 2 cut(s) 59, 349
RsaI GTAC 2 cut(s) 200, 367
RsaNI GTAC 2 cut(s) 199, 366
RseI CAYNNNNRTG 1 cut(s) 279
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 1 cut(s) 393
Sau3AI GATC 8 cut(s) 9, 59, 186, 228, 271, 277, 319, 349
Sau96I GGNCC 1 cut(s) 84
SchI GAGTC 1 cut(s) 383
SetI ASST 8 cut(s) 41, 54, 186, 194, 204, 309, 359, 394
SfaNI GCATC 2 cut(s) 217, 324
SinI GGWCC 1 cut(s) 84
SmiMI CAYNNNNRTG 1 cut(s) 279
SspMI CTAG 3 cut(s) 53, 96, 389
TaaI ACNGT 1 cut(s) 84
TaiI ACGT 1 cut(s) 186
TaqI TCGA 4 cut(s) 92, 231, 242, 262
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseI GCWGC 1 cut(s) 392
TspDTI ATGAA 3 cut(s) 17, 54, 140
Van91I CCANNNNNTGG 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 84
XmiI GTMKAC 2 cut(s) 71, 79
XspI CTAG 3 cut(s) 53, 96, 389
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.