Rw5G016990

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
21764613 .. 21765443
831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G016990.1

Sequence Viewer

Length: 408 bp
ATGAAGAAGATCAGTTTGCTATTAAGGAAGTGCAAGAGCTTGTCAAGCCAGCTAGGGAGATCTTCATCGTATAACAGTCTACGGTCCAAATCGACTAGAGAAGATTTGTATGATGGCAACATCATAAATGAGAATCATCAGCAAACTACTATATTTGTTGGAAGCACCAGAAAGCGTTACGTGATCAGCTCCAAGTACCTGAAGCATCCTTTGTTGAATGCTTTGATCGAGAAGTCATCGAATAAGCGAAATAGCAATCGAGGAGATGATCATGATCATGAGGATATCTTGGTGAAGTGTGAGGTGGTTCTCTTTGATCACTTGTTATGGATGCTGGAAAATGGAGATCCAAGCTTTGGTGGTACTTCAGAGTCTTTGGAGGAACTGGCTGCACTCTATGAGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.45

Weight (kDa)

7.8

Isoelectric Point (pI)

54.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 45 - 112 9.8e-14 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015978)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G12955
fragaria_vesca FvH4_3g15820
malus_domestica MD05G1219800.v1.1 MD10G1202100.v1.1
prunus_persica Prupe.4G140200_v2.0.a1
pyrus_communis pycom05g20110 pycom10g17290
rosa_chinensis RchiOBHm_Chr5g0026611
rosa_multiflora Rmu_sc0018952.1_g000005
rosa_rugosa Rorug05G0094200
rosa_samantha Rh5AG187600 Rh5BG184100 Rh5CG204100 Rh5DG186400
rosa_wichuraiana Rw5G016990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 356
AccI GTMKAC 1 cut(s) 79
AclWI GGATC 1 cut(s) 341
AcuI CTGAAG 2 cut(s) 221, 351
AfaI GTAC 2 cut(s) 197, 364
AfiI CCNNNNNNNGG 1 cut(s) 356
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 4 cut(s) 39, 52, 189, 354
AluI AGCT 4 cut(s) 39, 52, 189, 354
AlwI GGATC 1 cut(s) 341
ApeKI GCWGC 1 cut(s) 389
AspS9I GGNCC 1 cut(s) 84
AsuHPI GGTGA 1 cut(s) 304
AvaII GGWCC 1 cut(s) 84
BbvI GCAGC 1 cut(s) 376
BccI CCATC 1 cut(s) 107
BclI TGATCA 4 cut(s) 183, 268, 274, 316
BfaI CTAG 2 cut(s) 53, 96
BglII AGATCT 1 cut(s) 59
BisI GCNGC 1 cut(s) 390
BlsI GCNGC 1 cut(s) 391
Bme18I GGWCC 1 cut(s) 84
BmgT120I GGNCC 1 cut(s) 84
BmsI GCATC 2 cut(s) 214, 321
BsaAI YACGTR 1 cut(s) 181
BsaBI GATNNNNATC 2 cut(s) 64, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 356
Bse1I ACTGG 1 cut(s) 390
Bse8I GATNNNNATC 2 cut(s) 64, 273
BseGI GGATG 2 cut(s) 205, 336
BseJI GATNNNNATC 2 cut(s) 64, 273
BseLI CCNNNNNNNGG 1 cut(s) 356
BseNI ACTGG 1 cut(s) 390
BseRI GAGGAG 1 cut(s) 276
BseXI GCAGC 1 cut(s) 376
BsgI GTGCAG 1 cut(s) 375
BslI CCNNNNNNNGG 1 cut(s) 356
BsmI GAATGC 1 cut(s) 223
Bsp143I GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
BspHI TCATGA 2 cut(s) 271, 277
BspPI GGATC 1 cut(s) 341
BsrI ACTGG 1 cut(s) 390
BssMI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
Bst4CI ACNGT 2 cut(s) 77, 84
BstBAI YACGTR 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 50
BstF5I GGATG 2 cut(s) 205, 336
BstKTI GATC 8 cut(s) 12, 62, 186, 228, 271, 277, 319, 349
BstMBI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 376
BstX2I RGATCY 2 cut(s) 59, 346
BstYI RGATCY 2 cut(s) 59, 346
BtsCI GGATG 2 cut(s) 205, 336
Cac8I GCNNGC 1 cut(s) 50
CciI TCATGA 2 cut(s) 271, 277
Cfr13I GGNCC 1 cut(s) 84
Csp6I GTAC 2 cut(s) 196, 363
CviAII CATG 2 cut(s) 272, 278
CviJI RGCY 6 cut(s) 39, 48, 52, 189, 354, 389
CviKI_1 RGCY 6 cut(s) 39, 48, 52, 189, 354, 389
CviQI GTAC 2 cut(s) 196, 363
DpnI GATC 8 cut(s) 11, 61, 185, 227, 270, 276, 318, 348
DpnII GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
Eco32I GATATC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 84
Eco57I CTGAAG 2 cut(s) 221, 351
EcoRV GATATC 1 cut(s) 286
FaeI CATG 2 cut(s) 275, 281
FaiI YATR 8 cut(s) 72, 111, 125, 152, 273, 279, 328, 399
FatI CATG 2 cut(s) 271, 277
FbaI TGATCA 4 cut(s) 183, 268, 274, 316
FblI GTMKAC 1 cut(s) 79
Fnu4HI GCNGC 1 cut(s) 390
FokI GGATG 2 cut(s) 192, 343
Fsp4HI GCNGC 1 cut(s) 390
FspBI CTAG 2 cut(s) 53, 96
GluI GCNGC 1 cut(s) 390
Hin1II CATG 2 cut(s) 275, 281
HindIII AAGCTT 1 cut(s) 352
HinfI GANTC 2 cut(s) 133, 371
HphI GGTGA 1 cut(s) 304
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 370
Hpy188III TCNNGA 3 cut(s) 229, 272, 278
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4III ACNGT 2 cut(s) 77, 84
HpyCH4IV ACGT 1 cut(s) 180
HpyCH4V TGCA 2 cut(s) 33, 392
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 180
Hsp92II CATG 2 cut(s) 275, 281
Ksp22I TGATCA 4 cut(s) 183, 268, 274, 316
Kzo9I GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
LmnI GCTCC 1 cut(s) 194
LpnPI CCDG 5 cut(s) 62, 181, 212, 320, 371
Lsp1109I GCAGC 1 cut(s) 376
LweI GCATC 2 cut(s) 214, 321
MaeI CTAG 2 cut(s) 53, 96
MaeII ACGT 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 176
MalI GATC 8 cut(s) 11, 61, 185, 227, 270, 276, 318, 348
MboI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
MboII GAAGA 4 cut(s) 16, 19, 54, 113
MflI RGATCY 2 cut(s) 59, 346
MlyI GAGTC 1 cut(s) 380
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 4 cut(s) 254, 274, 295, 373
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 276
Mva1269I GAATGC 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
NlaIII CATG 2 cut(s) 275, 281
PagI TCATGA 2 cut(s) 271, 277
PctI GAATGC 1 cut(s) 223
PfeI GAWTC 1 cut(s) 133
PflMI CCANNNNNTGG 1 cut(s) 356
PkrI GCNGC 1 cut(s) 391
PleI GAGTC 1 cut(s) 379
PpsI GAGTC 1 cut(s) 379
Ppu21I YACGTR 1 cut(s) 181
PspPI GGNCC 1 cut(s) 84
PsuI RGATCY 2 cut(s) 59, 346
RsaI GTAC 2 cut(s) 197, 364
RsaNI GTAC 2 cut(s) 196, 363
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 1 cut(s) 390
Sau3AI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
Sau96I GGNCC 1 cut(s) 84
SchI GAGTC 1 cut(s) 380
SetI ASST 7 cut(s) 41, 54, 183, 191, 201, 306, 356
SfaNI GCATC 2 cut(s) 214, 321
SinI GGWCC 1 cut(s) 84
SmiMI CAYNNNNRTG 1 cut(s) 276
SspMI CTAG 2 cut(s) 53, 96
TaaI ACNGT 2 cut(s) 77, 84
TaiI ACGT 1 cut(s) 183
TaqI TCGA 4 cut(s) 92, 228, 239, 259
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseI GCWGC 1 cut(s) 389
TspDTI ATGAA 2 cut(s) 17, 54
Van91I CCANNNNNTGG 1 cut(s) 356
VpaK11BI GGWCC 1 cut(s) 84
XmiI GTMKAC 1 cut(s) 79
XspI CTAG 2 cut(s) 53, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.