Rh5DG038100

microtubule motor activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
2809157 .. 2809412
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG038100.1

Sequence Viewer

Length: 159 bp
ATGGCTTCACTAGACCAGACCCATGGTGATGTTGACTTCACAAAAGAACTAGTCCGGGCATTGCTGAATGAGAAGCTTGGTGATGAGGGGAACGGCAAAGAACTAGCTGAGCATATTGACGACCTTAAGGATTCAATGATGAAATGGTATGAGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.97

Weight (kDa)

4.46

Isoelectric Point (pI)

11.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016281)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 125
AgsI TTSAA 1 cut(s) 135
AhlI ACTAGT 1 cut(s) 49
AluBI AGCT 2 cut(s) 76, 107
AluI AGCT 2 cut(s) 76, 107
AsuC2I CCSGG 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 38, 92
BceAI ACGGC 1 cut(s) 109
BcnI CCSGG 1 cut(s) 56
BcuI ACTAGT 1 cut(s) 49
BfaI CTAG 3 cut(s) 11, 50, 104
BfrI CTTAAG 1 cut(s) 125
BlpI GCTNAGC 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 56
Bpu1102I GCTNAGC 1 cut(s) 108
BpuMI CCSGG 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 99
BsiSI CCGG 1 cut(s) 55
Bsp1720I GCTNAGC 1 cut(s) 108
Bsp19I CCATGG 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 100
BspTI CTTAAG 1 cut(s) 125
BsrDI GCAATG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 22
BstAFI CTTAAG 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 108
BstDSI CCRYGG 1 cut(s) 22
BstSCI CCNGG 1 cut(s) 54
BstXI CCANNNNNNTGG 1 cut(s) 23
BtgI CCRYGG 1 cut(s) 22
CviAII CATG 1 cut(s) 23
CviJI RGCY 3 cut(s) 5, 76, 107
CviKI_1 RGCY 3 cut(s) 5, 76, 107
DdeI CTNAG 1 cut(s) 108
Eco130I CCWWGG 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 22
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 1 cut(s) 26
FaiI YATR 3 cut(s) 24, 114, 150
FatI CATG 1 cut(s) 22
FspBI CTAG 3 cut(s) 11, 50, 104
HapII CCGG 1 cut(s) 55
Hin1II CATG 1 cut(s) 26
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HindIII AAGCTT 1 cut(s) 74
HinfI GANTC 1 cut(s) 131
HpaII CCGG 1 cut(s) 55
HphI GGTGA 2 cut(s) 38, 92
Hpy166II GTNNAC 1 cut(s) 34
Hpy8I GTNNAC 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 2 cut(s) 29, 68
MaeI CTAG 3 cut(s) 11, 50, 104
MnlI CCTC 2 cut(s) 79, 145
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 27
MspCI CTTAAG 1 cut(s) 125
MspI CCGG 1 cut(s) 55
MspR9I CCNGG 1 cut(s) 56
NciI CCSGG 1 cut(s) 56
NcoI CCATGG 1 cut(s) 22
NlaIII CATG 1 cut(s) 26
PfeI GAWTC 1 cut(s) 131
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 56
SetI ASST 3 cut(s) 78, 109, 126
SgeI CNNG 8 cut(s) 23, 28, 35, 62, 67, 68, 89, 116
SmiMI CAYNNNNRTG 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
SpeI ACTAGT 1 cut(s) 49
SspMI CTAG 3 cut(s) 11, 50, 104
StyD4I CCNGG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 22
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 155
Vha464I CTTAAG 1 cut(s) 125
XspI CTAG 3 cut(s) 11, 50, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.