Rh7AG275800

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0015785
Physical Location & Seq
Reverse (-)
28786278 .. 28786742
465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG275800.1

Sequence Viewer

Length: 465 bp
ATGCAGATCTTTGTGAAAACCCTAACCGGCAAGACCATCACCCTTGAGGTGGAGAGCTCTGACACCATCGACAACGTCAAAGCCAAAATCCAGGACAAGGAGGGCATCCCTCCAGATCAACAGAGGCTCATCTTCGCCGGAAAACAACTGGAGGAAGGACGGACCCTCCCCGACTATATCCAGAAGGAGGCGACTCTCCATCTCGTGCTCAGGCTTCGCGGTGGCATGCAAATTTTTGTGAAGACTTTTACTGGCAAGACCATCACTCTGGAGGTGGAGAGCTCCGATACCATTGACAATGTCAAGGCTAAGATTCAGGATCAGGAGGGTATCCTGCCGGATCAGCAGAGGCTGATCTTTGCCGGAAGGCAACTGGAGGATGGTCGTACATGGGCCGATTATAATATCCAAAAAGAGTCTACTCTGCACCTTGTACTTTGTCTCCGCGGTGGTGCTGATTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

154

Amino Acids

17.37

Weight (kDa)

5.45

Isoelectric Point (pI)

27.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 70 3.6e-14 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 73 2.5e-28 Ubiquitin family
Rad60-SLD PF11976 76 - 146 8.1e-15 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 78 - 146 8.2e-29 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015785)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G05050 AT4G05320
fragaria_vesca FvH4_6g15632
malus_domestica MD03G1210400.v1.1
pyrus_communis pycom12g11960
rosa_chinensis RchiOBHm_Chr7g0210981 RchiOBHm_Chr7g0213511
rosa_roxburghii Rroxscaffold_3G00245820
rosa_samantha Rh7AG255300 Rh7AG275800 Rh7CG271900 Rh7CG294700
rosa_wichuraiana Rw0G023470 Rw7G021840 Rw7G023830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 402
AccI GTMKAC 1 cut(s) 419
AccII CGCG 2 cut(s) 219, 447
AciI CCGC 3 cut(s) 219, 445, 447
AclWI GGATC 2 cut(s) 327, 348
AcsI RAATTY 1 cut(s) 231
AfaI GTAC 2 cut(s) 388, 435
AfiI CCNNNNNNNGG 3 cut(s) 49, 97, 187
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 2 cut(s) 57, 282
AluI AGCT 2 cut(s) 57, 282
Alw21I GWGCWC 3 cut(s) 59, 210, 284
Alw26I GTCTC 1 cut(s) 446
AlwI GGATC 2 cut(s) 327, 348
AlwNI CAGNNNCTG 1 cut(s) 352
AoxI GGCC 1 cut(s) 393
ApoI RAATTY 1 cut(s) 231
AspS9I GGNCC 2 cut(s) 162, 393
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 162
BanII GRGCYC 2 cut(s) 59, 284
BauI CACGAG 1 cut(s) 203
BbsI GAAGAC 1 cut(s) 248
Bbv12I GWGCWC 3 cut(s) 59, 210, 284
BccI CCATC 5 cut(s) 44, 74, 207, 269, 374
BciT130I CCWGG 1 cut(s) 92
BciVI GTATCC 1 cut(s) 341
BcoDI GTCTC 1 cut(s) 446
BfuI GTATCC 1 cut(s) 341
BglII AGATCT 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 162
BmgT120I GGNCC 2 cut(s) 162, 393
BmiI GGNNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 92
BmsI GCATC 1 cut(s) 114
BpiI GAAGAC 1 cut(s) 248
BpmI CTGGAG 4 cut(s) 96, 170, 290, 395
Bpu10I CCTNAGC 1 cut(s) 209
BpuEI CTTGAG 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 445
BsaXI ACNNNNNCTCC 4 cut(s) 150, 180, 426, 456
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 97, 187
Bse118I RCCGGY 1 cut(s) 26
Bse1I ACTGG 3 cut(s) 153, 256, 378
BseBI CCWGG 1 cut(s) 92
BseDI CCNNGG 1 cut(s) 445
BseGI GGATG 2 cut(s) 105, 385
BseLI CCNNNNNNNGG 3 cut(s) 49, 97, 187
BseMII CTCAG 1 cut(s) 223
BseNI ACTGG 3 cut(s) 153, 256, 378
BsgI GTGCAG 1 cut(s) 410
Bsh1236I CGCG 2 cut(s) 219, 447
BshFI GGCC 1 cut(s) 395
BsiHKAI GWGCWC 3 cut(s) 59, 210, 284
BsiSI CCGG 4 cut(s) 27, 138, 338, 363
BslI CCNNNNNNNGG 3 cut(s) 49, 97, 187
BsmAI GTCTC 1 cut(s) 446
BsnI GGCC 1 cut(s) 395
Bsp1286I GDGCHC 3 cut(s) 59, 210, 284
Bsp143I GATC 5 cut(s) 6, 115, 319, 340, 354
BspACI CCGC 3 cut(s) 219, 445, 447
BspANI GGCC 1 cut(s) 395
BspCNI CTCAG 1 cut(s) 222
BspFNI CGCG 2 cut(s) 219, 447
BspLI GGNNCC 1 cut(s) 164
BspPI GGATC 2 cut(s) 327, 348
BsrFI RCCGGY 1 cut(s) 26
BsrI ACTGG 3 cut(s) 153, 256, 378
BssAI RCCGGY 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 445
BssMI GATC 5 cut(s) 6, 115, 319, 340, 354
BssSI CACGAG 1 cut(s) 203
Bst2BI CACGAG 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 227
BstDEI CTNAG 2 cut(s) 209, 309
BstDSI CCRYGG 1 cut(s) 445
BstF5I GGATG 2 cut(s) 105, 385
BstFNI CGCG 2 cut(s) 219, 447
BstKTI GATC 5 cut(s) 9, 118, 322, 343, 357
BstMAI GTCTC 1 cut(s) 446
BstMBI GATC 5 cut(s) 6, 115, 319, 340, 354
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 90
BstUI CGCG 2 cut(s) 219, 447
BstV2I GAAGAC 1 cut(s) 248
BstX2I RGATCY 1 cut(s) 6
BstXI CCANNNNNNTGG 1 cut(s) 268
BstYI RGATCY 1 cut(s) 6
BsuI GTATCC 1 cut(s) 341
BsuRI GGCC 1 cut(s) 395
BtgI CCRYGG 1 cut(s) 445
BtsCI GGATG 2 cut(s) 105, 385
Cac8I GCNNGC 1 cut(s) 227
CaiI CAGNNNCTG 1 cut(s) 352
Cfr10I RCCGGY 1 cut(s) 26
Cfr13I GGNCC 2 cut(s) 162, 393
Cfr42I CCGCGG 1 cut(s) 448
Csp6I GTAC 2 cut(s) 387, 434
CviAII CATG 2 cut(s) 226, 390
CviJI RGCY 8 cut(s) 57, 83, 127, 214, 282, 308, 352, 395
CviKI_1 RGCY 8 cut(s) 57, 83, 127, 214, 282, 308, 352, 395
CviQI GTAC 2 cut(s) 387, 434
DdeI CTNAG 2 cut(s) 209, 309
DpnI GATC 5 cut(s) 8, 117, 321, 342, 356
DpnII GATC 5 cut(s) 6, 115, 319, 340, 354
Ecl136II GAGCTC 2 cut(s) 57, 282
Eco24I GRGCYC 2 cut(s) 59, 284
Eco47I GGWCC 1 cut(s) 162
Eco53kI GAGCTC 2 cut(s) 57, 282
EcoICRI GAGCTC 2 cut(s) 57, 282
EcoRII CCWGG 1 cut(s) 90
EcoT38I GRGCYC 2 cut(s) 59, 284
FaeI CATG 2 cut(s) 229, 393
FaiI YATR 4 cut(s) 177, 227, 391, 402
FatI CATG 2 cut(s) 225, 389
FblI GTMKAC 1 cut(s) 419
FokI GGATG 2 cut(s) 92, 392
FriOI GRGCYC 2 cut(s) 59, 284
GsuI CTGGAG 4 cut(s) 96, 170, 290, 395
HaeIII GGCC 1 cut(s) 395
HapII CCGG 4 cut(s) 27, 138, 338, 363
Hin1II CATG 2 cut(s) 229, 393
HinfI GANTC 3 cut(s) 193, 313, 416
HpaII CCGG 4 cut(s) 27, 138, 338, 363
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 420
Hpy188I TCNGA 3 cut(s) 61, 286, 464
Hpy188III TCNNGA 5 cut(s) 113, 181, 269, 317, 323
Hpy8I GTNNAC 1 cut(s) 420
HpyAV CCTTC 3 cut(s) 149, 178, 360
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 3 cut(s) 4, 229, 427
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
HpyF3I CTNAG 2 cut(s) 209, 309
HpySE526I ACGT 1 cut(s) 75
Hsp92II CATG 2 cut(s) 229, 393
KspI CCGCGG 1 cut(s) 448
Kzo9I GATC 5 cut(s) 6, 115, 319, 340, 354
LmnI GCTCC 1 cut(s) 287
LweI GCATC 1 cut(s) 114
MaeII ACGT 1 cut(s) 75
MalI GATC 5 cut(s) 8, 117, 321, 342, 356
MboI GATC 5 cut(s) 6, 115, 319, 340, 354
MboII GAAGA 2 cut(s) 124, 253
MflI RGATCY 1 cut(s) 6
MhlI GDGCHC 3 cut(s) 59, 210, 284
MluCI AATT 1 cut(s) 231
MlyI GAGTC 2 cut(s) 187, 425
MspA1I CMGCKG 1 cut(s) 447
MspI CCGG 4 cut(s) 27, 138, 338, 363
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MvnI CGCG 2 cut(s) 219, 447
MwoI GCNNNNNNNGC 1 cut(s) 343
NdeII GATC 5 cut(s) 6, 115, 319, 340, 354
NlaIII CATG 2 cut(s) 229, 393
NlaIV GGNNCC 1 cut(s) 164
NspI RCATGY 1 cut(s) 229
PaeI GCATGC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 313
PflFI GACNNNGTC 2 cut(s) 74, 299
PfoI TCCNGGA 1 cut(s) 90
PleI GAGTC 2 cut(s) 187, 424
PpsI GAGTC 2 cut(s) 187, 424
PsiI TTATAA 1 cut(s) 402
Psp124BI GAGCTC 2 cut(s) 59, 284
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 2 cut(s) 162, 393
PstNI CAGNNNCTG 1 cut(s) 352
PsuI RGATCY 1 cut(s) 6
PsyI GACNNNGTC 2 cut(s) 74, 299
RsaI GTAC 2 cut(s) 388, 435
RsaNI GTAC 2 cut(s) 387, 434
SacI GAGCTC 2 cut(s) 59, 284
SacII CCGCGG 1 cut(s) 448
Sau3AI GATC 5 cut(s) 6, 115, 319, 340, 354
Sau96I GGNCC 2 cut(s) 162, 393
SchI GAGTC 2 cut(s) 187, 425
ScrFI CCNGG 1 cut(s) 92
SduI GDGCHC 3 cut(s) 59, 210, 284
SetI ASST 6 cut(s) 51, 59, 78, 276, 284, 432
SfaNI GCATC 1 cut(s) 114
Sfr303I CCGCGG 1 cut(s) 448
SgrBI CCGCGG 1 cut(s) 448
SinI GGWCC 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SphI GCATGC 1 cut(s) 229
Sse9I AATT 1 cut(s) 231
SsiI CCGC 3 cut(s) 219, 445, 447
SstI GAGCTC 2 cut(s) 59, 284
StyD4I CCNGG 1 cut(s) 90
TaiI ACGT 1 cut(s) 78
TaqI TCGA 1 cut(s) 69
TasI AATT 1 cut(s) 231
TatI WGTACW 1 cut(s) 433
TfiI GAWTC 1 cut(s) 313
TspGWI ACGGA 1 cut(s) 175
Tth111I GACNNNGTC 2 cut(s) 74, 299
VpaK11BI GGWCC 1 cut(s) 162
XapI RAATTY 1 cut(s) 231
XceI RCATGY 1 cut(s) 229
XmiI GTMKAC 1 cut(s) 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.