Rh7CG323100

Something about silencing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
35184677 .. 35187668
2992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG323100.1

Sequence Viewer

Length: 276 bp
ATGGGATGGAAGCAACCCCAACTTGTCTCACTTGAACCAAAAGAAGTAGCTGTGTCGCATAACACAATCCAGTTGGAAAAAGTGAAGTCTCTGAGGGATGATGAAAAGACGGGAAAACGCAAACGTCAGAATGATGAATTTGATTTACAGAGCATGAAAATGTTGAAAGTAAGAGCTGCCCTTGAGGAAAAATTGAAGCAGAAGGGTATTTTCAATTCCATCACTCCAAGAACTGATAGACCCCAGAAATATCTGAAACCATTAAATGGAAGCTGA

Protein Analysis

91

Amino Acids

10.58

Weight (kDa)

9.94

Isoelectric Point (pI)

43.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018548)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 266
AcsI RAATTY 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 266
AgsI TTSAA 4 cut(s) 35, 166, 196, 214
AluBI AGCT 3 cut(s) 50, 176, 273
AluI AGCT 3 cut(s) 50, 176, 273
Alw26I GTCTC 2 cut(s) 31, 93
ApeKI GCWGC 1 cut(s) 176
ApoI RAATTY 1 cut(s) 137
BbvI GCAGC 1 cut(s) 163
BccI CCATC 1 cut(s) 227
BcoDI GTCTC 2 cut(s) 31, 93
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
BpuEI CTTGAG 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 70
BseGI GGATG 2 cut(s) 11, 103
BseLI CCNNNNNNNGG 1 cut(s) 266
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 70
BseXI GCAGC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 266
BsmAI GTCTC 2 cut(s) 31, 93
BspCNI CTCAG 1 cut(s) 84
BsrI ACTGG 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 92
BstF5I GGATG 2 cut(s) 11, 103
BstMAI GTCTC 2 cut(s) 31, 93
BstV1I GCAGC 1 cut(s) 163
BtsCI GGATG 2 cut(s) 11, 103
CviAII CATG 1 cut(s) 154
CviJI RGCY 3 cut(s) 50, 176, 273
CviKI_1 RGCY 3 cut(s) 50, 176, 273
DdeI CTNAG 1 cut(s) 92
FaeI CATG 1 cut(s) 157
FaiI YATR 2 cut(s) 60, 155
FatI CATG 1 cut(s) 153
Fnu4HI GCNGC 1 cut(s) 177
FokI GGATG 2 cut(s) 18, 110
Fsp4HI GCNGC 1 cut(s) 177
GluI GCNGC 1 cut(s) 177
Hin1II CATG 1 cut(s) 157
Hpy188I TCNGA 3 cut(s) 93, 129, 255
HpyAV CCTTC 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 1 cut(s) 157
LpnPI CCDG 2 cut(s) 83, 257
Lsp1109I GCAGC 1 cut(s) 163
MaeII ACGT 1 cut(s) 124
MluCI AATT 3 cut(s) 137, 191, 214
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 2 cut(s) 87, 178
MseI TTAA 1 cut(s) 263
MslI CAYNNNNRTG 1 cut(s) 158
NlaIII CATG 1 cut(s) 157
PflMI CCANNNNNTGG 1 cut(s) 266
PkrI GCNGC 1 cut(s) 178
RseI CAYNNNNRTG 1 cut(s) 158
SaqAI TTAA 1 cut(s) 263
SatI GCNGC 1 cut(s) 177
SetI ASST 4 cut(s) 52, 127, 178, 275
SgeI CNNG 8 cut(s) 35, 44, 82, 123, 166, 194, 240, 256
SmiMI CAYNNNNRTG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 3 cut(s) 137, 191, 214
TaiI ACGT 1 cut(s) 127
TasI AATT 3 cut(s) 137, 191, 214
Tru1I TTAA 1 cut(s) 263
Tru9I TTAA 1 cut(s) 263
TseI GCWGC 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 117, 150, 170
Van91I CCANNNNNTGG 1 cut(s) 266
XapI RAATTY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.