Rw5G048190

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0018954
Physical Location & Seq
Forward (+)
83676867 .. 83689565
12699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G048190.1

Sequence Viewer

Length: 285 bp
ATGCAACCAATTGCCAATAAAGTGATAAACTATGATGATCCAATTGATAGTATCATGTCAACAAGGCATGTAAACGAAAATGATGCAATCAGAAGATTGAAGTCAAAGTTTCTAATTCAGTTTGATGGAGTGACATCTAATCCTAATGATCGAGTAATTGTGAATTGGATGTGGAGGGAAATCAAACTTTTGGCTGCATCAAAACCGGTCATCGCATCAATGTCTGACGTGGCAACAAGTGGAGGATACTATATGGAAATGGCAGCAGATGCCATTGTTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

94

Amino Acids

10.53

Weight (kDa)

5.66

Isoelectric Point (pI)

40.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 64 - 94 1.9e-07 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018954)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0342911 RchiOBHm_Chr4g0433091
rosa_multiflora Rmu_sc0000361.1_g000021 Rmu_sc0001291.1_g000003
rosa_rugosa Rorug01G0181500 Rorug01G0181600
rosa_samantha Rh4AG319100 Rh4DG322500
rosa_wichuraiana Rw5G048190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 32
AgeI ACCGGT 1 cut(s) 205
AgsI TTSAA 1 cut(s) 100
AjiI CACGTC 1 cut(s) 229
AlwI GGATC 1 cut(s) 32
ApeKI GCWGC 2 cut(s) 194, 263
AsiGI ACCGGT 1 cut(s) 205
BbvI GCAGC 2 cut(s) 181, 275
BccI CCATC 1 cut(s) 119
BcgI CGANNNNNNTGC 2 cut(s) 65, 99
BciVI GTATCC 1 cut(s) 239
BfuI GTATCC 1 cut(s) 239
BisI GCNGC 2 cut(s) 195, 264
BlsI GCNGC 2 cut(s) 196, 265
BmgBI CACGTC 1 cut(s) 229
BmsI GCATC 4 cut(s) 73, 206, 224, 259
BsaWI WCCGGW 1 cut(s) 205
Bse118I RCCGGY 1 cut(s) 205
BseGI GGATG 1 cut(s) 174
BseXI GCAGC 2 cut(s) 181, 275
BshTI ACCGGT 1 cut(s) 205
BsiSI CCGG 1 cut(s) 206
Bsp143I GATC 2 cut(s) 37, 148
BspPI GGATC 1 cut(s) 32
BsrFI RCCGGY 1 cut(s) 205
BssAI RCCGGY 1 cut(s) 205
BssMI GATC 2 cut(s) 37, 148
BstAPI GCANNNNNTGC 1 cut(s) 269
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 2 cut(s) 40, 151
BstMBI GATC 2 cut(s) 37, 148
BstMWI GCNNNNNNNGC 2 cut(s) 269, 278
BstNSI RCATGY 1 cut(s) 71
BstV1I GCAGC 2 cut(s) 181, 275
BsuI GTATCC 1 cut(s) 239
BtgZI GCGATG 1 cut(s) 196
BtrI CACGTC 1 cut(s) 229
BtsCI GGATG 1 cut(s) 174
Cfr10I RCCGGY 1 cut(s) 205
CspAI ACCGGT 1 cut(s) 205
CviAII CATG 2 cut(s) 55, 68
CviJI RGCY 1 cut(s) 194
CviKI_1 RGCY 1 cut(s) 194
DpnI GATC 2 cut(s) 39, 150
DpnII GATC 2 cut(s) 37, 148
FaeI CATG 2 cut(s) 58, 71
FaiI YATR 6 cut(s) 33, 56, 69, 252, 254, 283
FatI CATG 2 cut(s) 54, 67
Fnu4HI GCNGC 2 cut(s) 195, 264
FokI GGATG 1 cut(s) 181
Fsp4HI GCNGC 2 cut(s) 195, 264
GluI GCNGC 2 cut(s) 195, 264
HapII CCGG 1 cut(s) 206
Hin1II CATG 2 cut(s) 58, 71
HincII GTYRAC 1 cut(s) 60
HindII GTYRAC 1 cut(s) 60
HpaII CCGG 1 cut(s) 206
Hpy166II GTNNAC 2 cut(s) 60, 73
Hpy188I TCNGA 2 cut(s) 92, 226
Hpy8I GTNNAC 2 cut(s) 60, 73
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 4 cut(s) 4, 86, 197, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 269, 278
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 2 cut(s) 58, 71
Kzo9I GATC 2 cut(s) 37, 148
LpnPI CCDG 1 cut(s) 219
Lsp1109I GCAGC 2 cut(s) 181, 275
LweI GCATC 4 cut(s) 73, 206, 224, 259
MaeII ACGT 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 130
MalI GATC 2 cut(s) 39, 150
MboI GATC 2 cut(s) 37, 148
MboII GAAGA 1 cut(s) 105
MfeI CAATTG 2 cut(s) 9, 42
MluCI AATT 5 cut(s) 9, 42, 114, 156, 163
MnlI CCTC 2 cut(s) 168, 236
MspI CCGG 1 cut(s) 206
MunI CAATTG 2 cut(s) 9, 42
MwoI GCNNNNNNNGC 2 cut(s) 269, 278
NdeII GATC 2 cut(s) 37, 148
NlaIII CATG 2 cut(s) 58, 71
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 71
PinAI ACCGGT 1 cut(s) 205
PkrI GCNGC 2 cut(s) 196, 265
SatI GCNGC 2 cut(s) 195, 264
Sau3AI GATC 2 cut(s) 37, 148
SetI ASST 1 cut(s) 231
SfaNI GCATC 4 cut(s) 73, 206, 224, 259
SgeI CNNG 7 cut(s) 67, 75, 80, 164, 218, 241, 249
Sse9I AATT 5 cut(s) 9, 42, 114, 156, 163
TaiI ACGT 1 cut(s) 231
TaqI TCGA 1 cut(s) 151
TasI AATT 5 cut(s) 9, 42, 114, 156, 163
TseFI GTSAC 1 cut(s) 130
TseI GCWGC 2 cut(s) 194, 263
Tsp45I GTSAC 1 cut(s) 130
XceI RCATGY 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.