AT1G01210

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
88622 .. 90502
1881 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G01210.3

Sequence Viewer

Length: 321 bp
ATGGAGTTTTGTCCAACATGTGGGAATCTGTTGCGATACGAGGGAGGTGGCAATTCGAGATTCTTCTGTTCCACATGTCCATACGTCGCCTACATCCAAAGACAGGTGGAGATAAAGAAGAAGCAACTTCTGGTTAAGAAATCTATAGAAGCTGTTGTGACTAAAGATGATATACCCACAGCTGCTGAAACTGAAGCCCCATGTCCAAGGTGTGGCCACGACAAGGCATACTTCAAATCAATGCAGATTCGTTCAGCAGATGAGCCAGAATCAAGATTTTATAGATGCTTGAAGTGCGAGTTCACTTGGCGTGAGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.27

Weight (kDa)

8.11

Isoelectric Point (pI)

39.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_RPB9 PF02150 1 - 29 3.1e-08 RNA polymerases M/15 Kd subunit
Zn_ribbon_TFIIS PF01096 67 - 104 1e-18 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 20, 212
AcoI YGGCCR 1 cut(s) 214
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 4 cut(s) 20, 103, 212, 223
AflIII ACRYGT 2 cut(s) 17, 74
AgsI TTSAA 2 cut(s) 235, 292
AluBI AGCT 2 cut(s) 152, 182
AluI AGCT 2 cut(s) 152, 182
AlwNI CAGNNNCTG 1 cut(s) 185
AoxI GGCC 1 cut(s) 214
ApeKI GCWGC 1 cut(s) 182
BalI TGGCCA 1 cut(s) 216
BbvI GCAGC 1 cut(s) 169
BfmI CTRYAG 1 cut(s) 144
BisI GCNGC 1 cut(s) 183
BlsI GCNGC 1 cut(s) 184
BmsI GCATC 1 cut(s) 275
BsaJI CCNNGG 1 cut(s) 206
Bsc4I CCNNNNNNNGG 4 cut(s) 20, 103, 212, 223
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 93
BseLI CCNNNNNNNGG 4 cut(s) 20, 103, 212, 223
BseXI GCAGC 1 cut(s) 169
BshFI GGCC 1 cut(s) 216
BslI CCNNNNNNNGG 4 cut(s) 20, 103, 212, 223
BsnI GGCC 1 cut(s) 216
BspANI GGCC 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 206
BssT1I CCWWGG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 294
BstNSI RCATGY 2 cut(s) 21, 78
BstSFI CTRYAG 1 cut(s) 144
BstV1I GCAGC 1 cut(s) 169
BsuRI GGCC 1 cut(s) 216
BtsCI GGATG 1 cut(s) 93
CaiI CAGNNNCTG 1 cut(s) 185
CviAII CATG 3 cut(s) 18, 75, 201
CviJI RGCY 5 cut(s) 152, 182, 197, 216, 265
CviKI_1 RGCY 5 cut(s) 152, 182, 197, 216, 265
EaeI YGGCCR 1 cut(s) 214
Eco130I CCWWGG 1 cut(s) 206
Eco57I CTGAAG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 206
ErhI CCWWGG 1 cut(s) 206
FaeI CATG 3 cut(s) 21, 78, 204
FaiI YATR 8 cut(s) 19, 76, 82, 146, 173, 202, 229, 282
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FatI CATG 3 cut(s) 17, 74, 200
Fnu4HI GCNGC 1 cut(s) 183
FokI GGATG 1 cut(s) 80
Fsp4HI GCNGC 1 cut(s) 183
GluI GCNGC 1 cut(s) 183
HaeIII GGCC 1 cut(s) 216
Hin1II CATG 3 cut(s) 21, 78, 204
HinfI GANTC 4 cut(s) 25, 60, 247, 269
Hpy166II GTNNAC 1 cut(s) 303
Hpy188III TCNNGA 2 cut(s) 57, 273
Hpy8I GTNNAC 1 cut(s) 303
Hpy99I CGWCG 1 cut(s) 89
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 1 cut(s) 244
HpyF10VI GCNNNNNNNGC 1 cut(s) 294
HpySE526I ACGT 1 cut(s) 84
Hsp92II CATG 3 cut(s) 21, 78, 204
LpnPI CCDG 3 cut(s) 89, 116, 279
Lsp1109I GCAGC 1 cut(s) 169
LweI GCATC 1 cut(s) 275
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 157
MboII GAAGA 2 cut(s) 55, 130
MlsI TGGCCA 1 cut(s) 216
MluCI AATT 1 cut(s) 52
MluNI TGGCCA 1 cut(s) 216
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 3 cut(s) 34, 38, 307
Mox20I TGGCCA 1 cut(s) 216
MscI TGGCCA 1 cut(s) 216
MseI TTAA 1 cut(s) 135
Msp20I TGGCCA 1 cut(s) 216
MspA1I CMGCKG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 294
NlaIII CATG 3 cut(s) 21, 78, 204
NmuCI GTSAC 1 cut(s) 157
NspI RCATGY 2 cut(s) 21, 78
PciI ACATGT 2 cut(s) 17, 74
PfeI GAWTC 4 cut(s) 25, 60, 247, 269
PflMI CCANNNNNTGG 2 cut(s) 20, 212
PkrI GCNGC 1 cut(s) 184
PscI ACATGT 2 cut(s) 17, 74
PstNI CAGNNNCTG 1 cut(s) 185
PvuII CAGCTG 1 cut(s) 182
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 1 cut(s) 183
SetI ASST 6 cut(s) 49, 87, 108, 154, 184, 212
SfaNI GCATC 1 cut(s) 275
SfcI CTRYAG 1 cut(s) 144
Sse9I AATT 1 cut(s) 52
StyI CCWWGG 1 cut(s) 206
TaiI ACGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 56
TasI AATT 1 cut(s) 52
TfiI GAWTC 4 cut(s) 25, 60, 247, 269
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseFI GTSAC 1 cut(s) 157
TseI GCWGC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 157
Van91I CCANNNNNTGG 2 cut(s) 20, 212
XceI RCATGY 2 cut(s) 21, 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.