MD01G1085300.v1.1

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
19184951 .. 19187695
2745 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1085300.v1.1.491

Sequence Viewer

Length: 336 bp
ATGGAGTTCTGCCCAGGTTGTGGTAACATGCTGCAGTATGAACTGCCGAATATGCACGATGCGAGATTCTTCTGTCCAACTTGTCCCTATGTAGCATACGTTGATAGGAAGGTGAAGATTAAAAGAAGGCAGCATCTAGTTAAAAAAGAGATACAGCCCATCTTTACCCTGGACGACTACAAGAATGCGCCCAAAACTGAAGAACCGTGCCCAAGATGCGGGTTTCCTGAGGCGGCTTACAGGACACAGCAAACACGATCTGCCGATGAACCAGAAACAAGATTCTACAGGTGTATGAACAACAATTGCGGACACACATGGGTTGATTACACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

13.15

Weight (kDa)

8.11

Isoelectric Point (pI)

48.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_TFIIS PF01096 69 - 107 1.5e-16 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 20
AciI CCGC 3 cut(s) 219, 233, 309
AcuI CTGAAG 1 cut(s) 219
AfiI CCNNNNNNNGG 2 cut(s) 20, 218
AjnI CCWGG 2 cut(s) 13, 168
ApeKI GCWGC 2 cut(s) 31, 130
AspLEI GCGC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 124
AxyI CCTNAGG 1 cut(s) 228
BaeGI GKGCMC 1 cut(s) 212
BbvI GCAGC 2 cut(s) 18, 142
BccI CCATC 1 cut(s) 167
BciT130I CCWGG 2 cut(s) 15, 170
BfaI CTAG 1 cut(s) 137
BfmI CTRYAG 2 cut(s) 32, 286
BisI GCNGC 3 cut(s) 32, 131, 234
BlsI GCNGC 3 cut(s) 33, 132, 235
Bme1390I CCNGG 2 cut(s) 15, 170
BmrFI CCNGG 2 cut(s) 15, 170
BmsI GCATC 3 cut(s) 49, 142, 206
BsaJI CCNNGG 2 cut(s) 13, 168
Bsc4I CCNNNNNNNGG 2 cut(s) 20, 218
Bse21I CCTNAGG 1 cut(s) 228
BseBI CCWGG 2 cut(s) 15, 170
BseDI CCNNGG 2 cut(s) 13, 168
BseLI CCNNNNNNNGG 2 cut(s) 20, 218
BseMII CTCAG 1 cut(s) 219
BseSI GKGCMC 1 cut(s) 212
BseXI GCAGC 2 cut(s) 18, 142
BslFI GGGAC 1 cut(s) 69
BslI CCNNNNNNNGG 2 cut(s) 20, 218
BsmFI GGGAC 1 cut(s) 69
BsmI GAATGC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 212
Bsp143I GATC 1 cut(s) 257
BspACI CCGC 3 cut(s) 219, 233, 309
BspCNI CTCAG 1 cut(s) 220
BspMAI CTGCAG 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 13, 168
BssMI GATC 1 cut(s) 257
Bst2UI CCWGG 2 cut(s) 15, 170
Bst4CI ACNGT 1 cut(s) 207
BstDEI CTNAG 2 cut(s) 228, 333
BstHHI GCGC 1 cut(s) 190
BstKTI GATC 1 cut(s) 260
BstMBI GATC 1 cut(s) 257
BstMWI GCNNNNNNNGC 2 cut(s) 52, 216
BstNI CCWGG 2 cut(s) 15, 170
BstNSI RCATGY 1 cut(s) 31
BstSCI CCNGG 2 cut(s) 13, 168
BstSFI CTRYAG 2 cut(s) 32, 286
BstSLI GKGCMC 1 cut(s) 212
BstV1I GCAGC 2 cut(s) 18, 142
Bsu36I CCTNAGG 1 cut(s) 228
CfoI GCGC 1 cut(s) 190
CviAII CATG 2 cut(s) 28, 318
CviJI RGCY 2 cut(s) 157, 236
CviKI_1 RGCY 2 cut(s) 157, 236
DdeI CTNAG 2 cut(s) 228, 333
DpnI GATC 1 cut(s) 259
DpnII GATC 1 cut(s) 257
Eco57I CTGAAG 1 cut(s) 219
Eco81I CCTNAGG 1 cut(s) 228
EcoRII CCWGG 2 cut(s) 13, 168
FaeI CATG 2 cut(s) 31, 321
FaiI YATR 7 cut(s) 29, 39, 53, 90, 97, 296, 319
FaqI GGGAC 1 cut(s) 69
FatI CATG 2 cut(s) 27, 317
FauI CCCGC 1 cut(s) 212
Fnu4HI GCNGC 3 cut(s) 32, 131, 234
Fsp4HI GCNGC 3 cut(s) 32, 131, 234
FspBI CTAG 1 cut(s) 137
GlaI GCGC 1 cut(s) 189
GluI GCNGC 3 cut(s) 32, 131, 234
HhaI GCGC 1 cut(s) 190
Hin1II CATG 2 cut(s) 31, 321
Hin6I GCGC 1 cut(s) 188
HinP1I GCGC 1 cut(s) 188
HinfI GANTC 2 cut(s) 66, 282
HphI GGTGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 227
HpyAV CCTTC 2 cut(s) 103, 120
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 99
HpyCH4V TGCA 2 cut(s) 34, 55
HpyF10VI GCNNNNNNNGC 2 cut(s) 52, 216
HpyF3I CTNAG 2 cut(s) 228, 333
HpySE526I ACGT 1 cut(s) 99
Hsp92II CATG 2 cut(s) 31, 321
HspAI GCGC 1 cut(s) 188
Kzo9I GATC 1 cut(s) 257
LpnPI CCDG 7 cut(s) 27, 155, 182, 226, 240, 274, 285
Lsp1109I GCAGC 2 cut(s) 18, 142
LweI GCATC 3 cut(s) 49, 142, 206
MaeI CTAG 1 cut(s) 137
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 23
MalI GATC 1 cut(s) 259
MboI GATC 1 cut(s) 257
MboII GAAGA 3 cut(s) 61, 127, 212
MfeI CAATTG 1 cut(s) 304
MhlI GDGCHC 1 cut(s) 212
MluCI AATT 1 cut(s) 304
MmeI TCCRAC 1 cut(s) 101
MnlI CCTC 1 cut(s) 223
MseI TTAA 2 cut(s) 120, 141
MspR9I CCNGG 2 cut(s) 15, 170
MunI CAATTG 1 cut(s) 304
Mva1269I GAATGC 1 cut(s) 190
MvaI CCWGG 2 cut(s) 15, 170
MwoI GCNNNNNNNGC 2 cut(s) 52, 216
NdeII GATC 1 cut(s) 257
NlaIII CATG 2 cut(s) 31, 321
NspI RCATGY 1 cut(s) 31
PctI GAATGC 1 cut(s) 190
PfeI GAWTC 2 cut(s) 66, 282
PflMI CCANNNNNTGG 1 cut(s) 20
PkrI GCNGC 3 cut(s) 33, 132, 235
Psp6I CCWGG 2 cut(s) 13, 168
PspGI CCWGG 2 cut(s) 13, 168
PstI CTGCAG 1 cut(s) 36
SaqAI TTAA 2 cut(s) 120, 141
SatI GCNGC 3 cut(s) 32, 131, 234
Sau3AI GATC 1 cut(s) 257
ScrFI CCNGG 2 cut(s) 15, 170
SduI GDGCHC 1 cut(s) 212
SetI ASST 4 cut(s) 19, 102, 114, 293
SfaNI GCATC 3 cut(s) 49, 142, 206
SfcI CTRYAG 2 cut(s) 32, 286
Sse9I AATT 1 cut(s) 304
SsiI CCGC 3 cut(s) 219, 233, 309
SspMI CTAG 1 cut(s) 137
StyD4I CCNGG 2 cut(s) 13, 168
TaaI ACNGT 1 cut(s) 207
TaiI ACGT 1 cut(s) 102
TasI AATT 1 cut(s) 304
TauI GCSGC 1 cut(s) 236
TfiI GAWTC 2 cut(s) 66, 282
Tru1I TTAA 2 cut(s) 120, 141
Tru9I TTAA 2 cut(s) 120, 141
TseI GCWGC 2 cut(s) 31, 130
TspDTI ATGAA 3 cut(s) 54, 282, 311
Van91I CCANNNNNTGG 1 cut(s) 20
XceI RCATGY 1 cut(s) 31
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.