Rw1G025790

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
52562439 .. 52564780
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G025790.1

Sequence Viewer

Length: 336 bp
ATGGAATTCTGCCCGGATTGTGGAGGCATGCTGCAGTATGAGCTTCCGAATATGCACGCTGCTAGATTCTTCTGTCCAACTTGTCCTTATGTAGCATACATGGAGAAACAGGGTGAAATTAGGAGGAGGCAGGCTCTAGTTAAGAAGGAGATCCAACCCATAATTAACTTGAATGACTTTACAAATGCACCCAAAACTGAAGAAACATGCCCAATCTGTGGTCATAAAGAGGCTGCTTTCCGGGAACAGCAAACACGATCTGCTGATGAAGCATCAACAAAATTTTATAGGTGTTTGAACGAAGACTGTAAACATGCTTGGATCGATTACTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.92

Weight (kDa)

5.9

Isoelectric Point (pI)

66.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_Nudix PF14803 3 - 33 4.9e-06 Nudix N-terminal
Zn_ribbon_TFIIS PF01096 69 - 107 3.7e-15 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 218
AclWI GGATC 2 cut(s) 145, 329
AcsI RAATTY 2 cut(s) 5, 281
AcuI CTGAAG 1 cut(s) 219
AfiI CCNNNNNNNGG 2 cut(s) 20, 218
AgsI TTSAA 2 cut(s) 172, 298
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AlwI GGATC 2 cut(s) 145, 329
ApeKI GCWGC 3 cut(s) 31, 59, 233
ApoI RAATTY 2 cut(s) 5, 281
AsuC2I CCSGG 2 cut(s) 14, 242
AsuHPI GGTGA 1 cut(s) 125
BbsI GAAGAC 1 cut(s) 309
BbvI GCAGC 3 cut(s) 18, 46, 220
BcnI CCSGG 2 cut(s) 14, 242
BfaI CTAG 2 cut(s) 63, 137
BfmI CTRYAG 1 cut(s) 32
BisI GCNGC 3 cut(s) 32, 60, 234
BlsI GCNGC 3 cut(s) 33, 61, 235
Bme1390I CCNGG 2 cut(s) 14, 242
BmrFI CCNGG 2 cut(s) 14, 242
BmsI GCATC 1 cut(s) 281
BpiI GAAGAC 1 cut(s) 309
BplI GAGNNNNNCTC 2 cut(s) 118, 150
BpuMI CCSGG 2 cut(s) 14, 242
Bsa29I ATCGAT 1 cut(s) 324
Bsc4I CCNNNNNNNGG 2 cut(s) 20, 218
BseCI ATCGAT 1 cut(s) 324
BseLI CCNNNNNNNGG 2 cut(s) 20, 218
BseRI GAGGAG 1 cut(s) 139
BseXI GCAGC 3 cut(s) 18, 46, 220
BshVI ATCGAT 1 cut(s) 324
BsiSI CCGG 2 cut(s) 14, 241
BslI CCNNNNNNNGG 2 cut(s) 20, 218
Bsp143I GATC 3 cut(s) 150, 257, 321
BspDI ATCGAT 1 cut(s) 324
BspMAI CTGCAG 1 cut(s) 36
BspPI GGATC 2 cut(s) 145, 329
BssMI GATC 3 cut(s) 150, 257, 321
Bst4CI ACNGT 1 cut(s) 308
BstC8I GCNNGC 3 cut(s) 29, 57, 132
BstDEI CTNAG 1 cut(s) 333
BstKTI GATC 3 cut(s) 153, 260, 324
BstMBI GATC 3 cut(s) 150, 257, 321
BstMWI GCNNNNNNNGC 2 cut(s) 40, 269
BstNSI RCATGY 3 cut(s) 31, 210, 317
BstSCI CCNGG 2 cut(s) 12, 240
BstSFI CTRYAG 1 cut(s) 32
BstV1I GCAGC 3 cut(s) 18, 46, 220
BstV2I GAAGAC 1 cut(s) 309
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
Bsu15I ATCGAT 1 cut(s) 324
BsuTUI ATCGAT 1 cut(s) 324
Cac8I GCNNGC 3 cut(s) 29, 57, 132
ClaI ATCGAT 1 cut(s) 324
CviAII CATG 4 cut(s) 28, 100, 207, 314
CviJI RGCY 3 cut(s) 43, 134, 233
CviKI_1 RGCY 3 cut(s) 43, 134, 233
DdeI CTNAG 1 cut(s) 333
DpnI GATC 3 cut(s) 152, 259, 323
DpnII GATC 3 cut(s) 150, 257, 321
Eco57I CTGAAG 1 cut(s) 219
EcoRI GAATTC 1 cut(s) 5
FaeI CATG 4 cut(s) 31, 103, 210, 317
FatI CATG 4 cut(s) 27, 99, 206, 313
Fnu4HI GCNGC 3 cut(s) 32, 60, 234
Fsp4HI GCNGC 3 cut(s) 32, 60, 234
FspBI CTAG 2 cut(s) 63, 137
GluI GCNGC 3 cut(s) 32, 60, 234
HapII CCGG 2 cut(s) 14, 241
Hin1II CATG 4 cut(s) 31, 103, 210, 317
HinfI GANTC 1 cut(s) 66
HpaII CCGG 2 cut(s) 14, 241
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 311
HpyAV CCTTC 1 cut(s) 139
HpyCH4III ACNGT 1 cut(s) 308
HpyCH4V TGCA 3 cut(s) 34, 55, 188
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 269
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 4 cut(s) 31, 103, 210, 317
Kzo9I GATC 3 cut(s) 150, 257, 321
LpnPI CCDG 4 cut(s) 27, 95, 116, 254
Lsp1109I GCAGC 3 cut(s) 18, 46, 220
LweI GCATC 1 cut(s) 281
MaeI CTAG 2 cut(s) 63, 137
MalI GATC 3 cut(s) 152, 259, 323
MboI GATC 3 cut(s) 150, 257, 321
MboII GAAGA 3 cut(s) 61, 212, 314
MflI RGATCY 1 cut(s) 150
MluCI AATT 4 cut(s) 5, 117, 162, 281
MmeI TCCRAC 2 cut(s) 101, 178
MnlI CCTC 4 cut(s) 17, 117, 120, 223
MseI TTAA 2 cut(s) 141, 165
MspI CCGG 2 cut(s) 14, 241
MspR9I CCNGG 2 cut(s) 14, 242
MwoI GCNNNNNNNGC 2 cut(s) 40, 269
NciI CCSGG 2 cut(s) 14, 242
NdeII GATC 3 cut(s) 150, 257, 321
NlaIII CATG 4 cut(s) 31, 103, 210, 317
NspI RCATGY 3 cut(s) 31, 210, 317
PaeI GCATGC 1 cut(s) 31
PfeI GAWTC 1 cut(s) 66
PflMI CCANNNNNTGG 1 cut(s) 218
PfoI TCCNGGA 1 cut(s) 240
PkrI GCNGC 3 cut(s) 33, 61, 235
PstI CTGCAG 1 cut(s) 36
PsuI RGATCY 1 cut(s) 150
SaqAI TTAA 2 cut(s) 141, 165
SatI GCNGC 3 cut(s) 32, 60, 234
Sau3AI GATC 3 cut(s) 150, 257, 321
ScrFI CCNGG 2 cut(s) 14, 242
SetI ASST 2 cut(s) 45, 293
SfaNI GCATC 1 cut(s) 281
SfcI CTRYAG 1 cut(s) 32
SphI GCATGC 1 cut(s) 31
Sse9I AATT 4 cut(s) 5, 117, 162, 281
SspMI CTAG 2 cut(s) 63, 137
StyD4I CCNGG 2 cut(s) 12, 240
TaaI ACNGT 1 cut(s) 308
TaqI TCGA 1 cut(s) 324
TasI AATT 4 cut(s) 5, 117, 162, 281
TfiI GAWTC 1 cut(s) 66
Tru1I TTAA 2 cut(s) 141, 165
Tru9I TTAA 2 cut(s) 141, 165
TseI GCWGC 3 cut(s) 31, 59, 233
TspDTI ATGAA 1 cut(s) 282
Van91I CCANNNNNTGG 1 cut(s) 218
XapI RAATTY 2 cut(s) 5, 281
XceI RCATGY 3 cut(s) 31, 210, 317
XspI CTAG 2 cut(s) 63, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.