RLG00000027805

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
15389303 .. 15391457
2155 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000027805

Sequence Viewer

Length: 498 bp
ATGAAAAATTCATTGTTTATGAGTAATGACTGTTTGCCTAAAATCCGAACAAAGAACAGTCAGAGACTGAGATTAGGGTTTAACGCAAAACCCTGCCAAATTCGACCCGAATTCCTCAATCTATCGAAAAGGAGGGAGAGTTGTGGGGGGAGATTTTCGCAAATGGAATTCTGCCCAGATTGTGGAGGCATGCTACAGTATGAGCTTCCGAATATGCATGCTGCTAGATTCTTCTGTCCAACTTGTCCTTATGTAGCATACATGGAGAAACGGGGTGAAATTAGGAGGAGGGAGGCTCTAGTTAAGAAGGAGATCCAACCCATAATTAACCTGAATGACTTTACAAATGCACCCAAAACTGAAGAAACATGCCCAATCTGTGGTCATAAAGAGGCTGCTTTCCGGGAACAGCAAACACGATCTGCTGATGAAGCATCAACAAAATTTTATAGGTGTTTGAACGAAGACTGTAAGCATGCTTGGATCGATTACTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

19.23

Weight (kDa)

8.89

Isoelectric Point (pI)

64.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_Nudix PF14803 57 - 87 9.9e-06 Nudix N-terminal
Zn_ribbon_TFIIS PF01096 123 - 161 8.1e-15 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 182, 380
AclWI GGATC 2 cut(s) 307, 491
AcsI RAATTY 5 cut(s) 7, 99, 110, 167, 443
AcuI CTGAAG 1 cut(s) 381
AfiI CCNNNNNNNGG 2 cut(s) 182, 380
AgsI TTSAA 1 cut(s) 460
AluBI AGCT 1 cut(s) 205
AluI AGCT 1 cut(s) 205
Alw26I GTCTC 1 cut(s) 58
AlwI GGATC 2 cut(s) 307, 491
AlwNI CAGNNNCTG 1 cut(s) 67
ApeKI GCWGC 2 cut(s) 221, 395
ApoI RAATTY 5 cut(s) 7, 99, 110, 167, 443
AsuC2I CCSGG 1 cut(s) 404
AsuHPI GGTGA 1 cut(s) 287
BbsI GAAGAC 1 cut(s) 471
BbvI GCAGC 2 cut(s) 208, 382
BcnI CCSGG 1 cut(s) 404
BcoDI GTCTC 1 cut(s) 58
BfaI CTAG 2 cut(s) 225, 299
BfmI CTRYAG 1 cut(s) 194
BisI GCNGC 2 cut(s) 222, 396
BlsI GCNGC 2 cut(s) 223, 397
Bme1390I CCNGG 1 cut(s) 404
BmrFI CCNGG 1 cut(s) 404
BmsI GCATC 1 cut(s) 443
BpiI GAAGAC 1 cut(s) 471
BplI GAGNNNNNCTC 2 cut(s) 280, 312
BpuMI CCSGG 1 cut(s) 404
Bsa29I ATCGAT 1 cut(s) 486
BsaXI ACNNNNNCTCC 2 cut(s) 124, 154
Bsc4I CCNNNNNNNGG 2 cut(s) 182, 380
BseCI ATCGAT 1 cut(s) 486
BseLI CCNNNNNNNGG 2 cut(s) 182, 380
BseMII CTCAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 301
BseXI GCAGC 2 cut(s) 208, 382
BshVI ATCGAT 1 cut(s) 486
BsiSI CCGG 1 cut(s) 403
BslI CCNNNNNNNGG 2 cut(s) 182, 380
BsmAI GTCTC 1 cut(s) 58
Bsp143I GATC 3 cut(s) 312, 419, 483
BspCNI CTCAG 1 cut(s) 60
BspDI ATCGAT 1 cut(s) 486
BspPI GGATC 2 cut(s) 307, 491
BssMI GATC 3 cut(s) 312, 419, 483
Bst4CI ACNGT 4 cut(s) 32, 59, 198, 470
BstC8I GCNNGC 3 cut(s) 191, 219, 477
BstDEI CTNAG 2 cut(s) 68, 495
BstKTI GATC 3 cut(s) 315, 422, 486
BstMAI GTCTC 1 cut(s) 58
BstMBI GATC 3 cut(s) 312, 419, 483
BstMWI GCNNNNNNNGC 1 cut(s) 431
BstNSI RCATGY 4 cut(s) 193, 221, 372, 479
BstSCI CCNGG 1 cut(s) 402
BstSFI CTRYAG 1 cut(s) 194
BstV1I GCAGC 2 cut(s) 208, 382
BstV2I GAAGAC 1 cut(s) 471
BstX2I RGATCY 1 cut(s) 312
BstYI RGATCY 1 cut(s) 312
Bsu15I ATCGAT 1 cut(s) 486
BsuTUI ATCGAT 1 cut(s) 486
Cac8I GCNNGC 3 cut(s) 191, 219, 477
CaiI CAGNNNCTG 1 cut(s) 67
ClaI ATCGAT 1 cut(s) 486
CviAII CATG 5 cut(s) 190, 218, 262, 369, 476
CviJI RGCY 3 cut(s) 205, 296, 395
CviKI_1 RGCY 3 cut(s) 205, 296, 395
DdeI CTNAG 2 cut(s) 68, 495
DpnI GATC 3 cut(s) 314, 421, 485
DpnII GATC 3 cut(s) 312, 419, 483
Eco57I CTGAAG 1 cut(s) 381
EcoRI GAATTC 2 cut(s) 110, 167
EcoT22I ATGCAT 1 cut(s) 219
FaeI CATG 5 cut(s) 193, 221, 265, 372, 479
FatI CATG 5 cut(s) 189, 217, 261, 368, 475
Fnu4HI GCNGC 2 cut(s) 222, 396
Fsp4HI GCNGC 2 cut(s) 222, 396
FspBI CTAG 2 cut(s) 225, 299
GluI GCNGC 2 cut(s) 222, 396
HapII CCGG 1 cut(s) 403
Hin1II CATG 5 cut(s) 193, 221, 265, 372, 479
HinfI GANTC 1 cut(s) 228
HpaII CCGG 1 cut(s) 403
HphI GGTGA 1 cut(s) 287
Hpy188I TCNGA 3 cut(s) 47, 63, 210
HpyAV CCTTC 1 cut(s) 301
HpyCH4III ACNGT 4 cut(s) 32, 59, 198, 470
HpyCH4V TGCA 2 cut(s) 217, 350
HpyF10VI GCNNNNNNNGC 1 cut(s) 431
HpyF3I CTNAG 2 cut(s) 68, 495
Hsp92II CATG 5 cut(s) 193, 221, 265, 372, 479
Kzo9I GATC 3 cut(s) 312, 419, 483
LpnPI CCDG 4 cut(s) 106, 189, 344, 416
Lsp1109I GCAGC 2 cut(s) 208, 382
LweI GCATC 1 cut(s) 443
MaeI CTAG 2 cut(s) 225, 299
MalI GATC 3 cut(s) 314, 421, 485
MboI GATC 3 cut(s) 312, 419, 483
MboII GAAGA 3 cut(s) 223, 374, 476
MflI RGATCY 1 cut(s) 312
MluCI AATT 7 cut(s) 7, 99, 110, 167, 279, 324, 443
MmeI TCCRAC 2 cut(s) 263, 340
MnlI CCTC 7 cut(s) 125, 126, 179, 279, 282, 286, 385
Mph1103I ATGCAT 1 cut(s) 219
MseI TTAA 3 cut(s) 81, 303, 327
MspI CCGG 1 cut(s) 403
MspR9I CCNGG 1 cut(s) 404
MwoI GCNNNNNNNGC 1 cut(s) 431
NciI CCSGG 1 cut(s) 404
NdeII GATC 3 cut(s) 312, 419, 483
NlaIII CATG 5 cut(s) 193, 221, 265, 372, 479
NsiI ATGCAT 1 cut(s) 219
NspI RCATGY 4 cut(s) 193, 221, 372, 479
PaeI GCATGC 3 cut(s) 193, 221, 479
PfeI GAWTC 1 cut(s) 228
PflMI CCANNNNNTGG 2 cut(s) 182, 380
PfoI TCCNGGA 1 cut(s) 402
PkrI GCNGC 2 cut(s) 223, 397
PstNI CAGNNNCTG 1 cut(s) 67
PsuI RGATCY 1 cut(s) 312
SaqAI TTAA 3 cut(s) 81, 303, 327
SatI GCNGC 2 cut(s) 222, 396
Sau3AI GATC 3 cut(s) 312, 419, 483
ScrFI CCNGG 1 cut(s) 404
SetI ASST 3 cut(s) 207, 333, 455
SfaNI GCATC 1 cut(s) 443
SfcI CTRYAG 1 cut(s) 194
SphI GCATGC 3 cut(s) 193, 221, 479
Sse9I AATT 7 cut(s) 7, 99, 110, 167, 279, 324, 443
SspMI CTAG 2 cut(s) 225, 299
StyD4I CCNGG 1 cut(s) 402
TaaI ACNGT 4 cut(s) 32, 59, 198, 470
TaqI TCGA 3 cut(s) 103, 125, 486
TasI AATT 7 cut(s) 7, 99, 110, 167, 279, 324, 443
TfiI GAWTC 1 cut(s) 228
Tru1I TTAA 3 cut(s) 81, 303, 327
Tru9I TTAA 3 cut(s) 81, 303, 327
TseI GCWGC 2 cut(s) 221, 395
TspDTI ATGAA 2 cut(s) 17, 444
Van91I CCANNNNNTGG 2 cut(s) 182, 380
XapI RAATTY 5 cut(s) 7, 99, 110, 167, 443
XceI RCATGY 4 cut(s) 193, 221, 372, 479
XspI CTAG 2 cut(s) 225, 299
Zsp2I ATGCAT 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.