Rh1CG273900

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
54071752 .. 54073261
1510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG273900.1

Sequence Viewer

Length: 402 bp
ATGGCATCTCGGAATCTAAACAAACATTATGCAGGGAGGGAGAGTTGTGTTGGGAGATTTTCGCAAATGGAATTCTGCCCGGATTGTGGAGGCATGCTGCAGTATGAGCTTCCGAATATGCACGCTGCTAGATTCTTCTGTCCAACTTGTCCTTATGTAGCATACATGGAGAAACAGGGTGAAATTAGGAGGAGGCAGGCTCTAGTTAAGAAGGAGATCCAACCCATAATTAACTTGAATGACTTTACAAATGCACCCAAAACTGAAGAAACATGCCCAATCTGTGGTCATAAAGAGGCTGCTTTCCGGGAACAGCAAACACGATCTGCTGATGAAGCATCAACAAAATTTTATAGGTGTTTGAACGAAGACTGTAAACATGCTTGGATCGATTACTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.41

Weight (kDa)

7.53

Isoelectric Point (pI)

71.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_Nudix PF14803 25 - 55 6.9e-06 Nudix N-terminal
Zn_ribbon_TFIIS PF01096 91 - 129 5.4e-15 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 284
AclWI GGATC 2 cut(s) 211, 395
AcsI RAATTY 2 cut(s) 71, 347
AcuI CTGAAG 1 cut(s) 285
AfiI CCNNNNNNNGG 2 cut(s) 86, 284
AgsI TTSAA 2 cut(s) 238, 364
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AlwI GGATC 2 cut(s) 211, 395
ApeKI GCWGC 3 cut(s) 97, 125, 299
ApoI RAATTY 2 cut(s) 71, 347
AsuC2I CCSGG 2 cut(s) 80, 308
AsuHPI GGTGA 1 cut(s) 191
BbsI GAAGAC 1 cut(s) 375
BbvI GCAGC 3 cut(s) 84, 112, 286
BcnI CCSGG 2 cut(s) 80, 308
BfaI CTAG 2 cut(s) 129, 203
BfmI CTRYAG 1 cut(s) 98
BisI GCNGC 3 cut(s) 98, 126, 300
BlsI GCNGC 3 cut(s) 99, 127, 301
Bme1390I CCNGG 2 cut(s) 80, 308
BmrFI CCNGG 2 cut(s) 80, 308
BmsI GCATC 2 cut(s) 14, 347
BpiI GAAGAC 1 cut(s) 375
BplI GAGNNNNNCTC 2 cut(s) 184, 216
BpuMI CCSGG 2 cut(s) 80, 308
Bsa29I ATCGAT 1 cut(s) 390
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 284
BseCI ATCGAT 1 cut(s) 390
BseLI CCNNNNNNNGG 2 cut(s) 86, 284
BseRI GAGGAG 1 cut(s) 205
BseXI GCAGC 3 cut(s) 84, 112, 286
BshVI ATCGAT 1 cut(s) 390
BsiSI CCGG 2 cut(s) 80, 307
BslI CCNNNNNNNGG 2 cut(s) 86, 284
Bsp143I GATC 3 cut(s) 216, 323, 387
BspDI ATCGAT 1 cut(s) 390
BspMAI CTGCAG 1 cut(s) 102
BspPI GGATC 2 cut(s) 211, 395
BssMI GATC 3 cut(s) 216, 323, 387
Bst4CI ACNGT 1 cut(s) 374
BstC8I GCNNGC 3 cut(s) 95, 123, 198
BstDEI CTNAG 1 cut(s) 399
BstKTI GATC 3 cut(s) 219, 326, 390
BstMBI GATC 3 cut(s) 216, 323, 387
BstMWI GCNNNNNNNGC 2 cut(s) 106, 335
BstNSI RCATGY 3 cut(s) 97, 276, 383
BstSCI CCNGG 2 cut(s) 78, 306
BstSFI CTRYAG 1 cut(s) 98
BstV1I GCAGC 3 cut(s) 84, 112, 286
BstV2I GAAGAC 1 cut(s) 375
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
Bsu15I ATCGAT 1 cut(s) 390
BsuTUI ATCGAT 1 cut(s) 390
Cac8I GCNNGC 3 cut(s) 95, 123, 198
ClaI ATCGAT 1 cut(s) 390
CviAII CATG 4 cut(s) 94, 166, 273, 380
CviJI RGCY 3 cut(s) 109, 200, 299
CviKI_1 RGCY 3 cut(s) 109, 200, 299
DdeI CTNAG 1 cut(s) 399
DpnI GATC 3 cut(s) 218, 325, 389
DpnII GATC 3 cut(s) 216, 323, 387
Eco57I CTGAAG 1 cut(s) 285
EcoRI GAATTC 1 cut(s) 71
FaeI CATG 4 cut(s) 97, 169, 276, 383
FatI CATG 4 cut(s) 93, 165, 272, 379
Fnu4HI GCNGC 3 cut(s) 98, 126, 300
Fsp4HI GCNGC 3 cut(s) 98, 126, 300
FspBI CTAG 2 cut(s) 129, 203
GluI GCNGC 3 cut(s) 98, 126, 300
HapII CCGG 2 cut(s) 80, 307
Hin1II CATG 4 cut(s) 97, 169, 276, 383
HinfI GANTC 2 cut(s) 13, 132
HpaII CCGG 2 cut(s) 80, 307
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 377
Hpy188I TCNGA 2 cut(s) 12, 114
Hpy8I GTNNAC 1 cut(s) 377
HpyAV CCTTC 1 cut(s) 205
HpyCH4III ACNGT 1 cut(s) 374
HpyCH4V TGCA 4 cut(s) 32, 100, 121, 254
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 335
HpyF3I CTNAG 1 cut(s) 399
Hsp92II CATG 4 cut(s) 97, 169, 276, 383
Kzo9I GATC 3 cut(s) 216, 323, 387
LpnPI CCDG 5 cut(s) 18, 93, 161, 182, 320
Lsp1109I GCAGC 3 cut(s) 84, 112, 286
LweI GCATC 2 cut(s) 14, 347
MaeI CTAG 2 cut(s) 129, 203
MalI GATC 3 cut(s) 218, 325, 389
MboI GATC 3 cut(s) 216, 323, 387
MboII GAAGA 3 cut(s) 127, 278, 380
MflI RGATCY 1 cut(s) 216
MluCI AATT 4 cut(s) 71, 183, 228, 347
MmeI TCCRAC 2 cut(s) 167, 244
MnlI CCTC 5 cut(s) 30, 83, 183, 186, 289
MseI TTAA 2 cut(s) 207, 231
MspI CCGG 2 cut(s) 80, 307
MspR9I CCNGG 2 cut(s) 80, 308
MwoI GCNNNNNNNGC 2 cut(s) 106, 335
NciI CCSGG 2 cut(s) 80, 308
NdeII GATC 3 cut(s) 216, 323, 387
NlaIII CATG 4 cut(s) 97, 169, 276, 383
NspI RCATGY 3 cut(s) 97, 276, 383
PaeI GCATGC 1 cut(s) 97
PfeI GAWTC 2 cut(s) 13, 132
PflMI CCANNNNNTGG 1 cut(s) 284
PfoI TCCNGGA 1 cut(s) 306
PkrI GCNGC 3 cut(s) 99, 127, 301
PstI CTGCAG 1 cut(s) 102
PsuI RGATCY 1 cut(s) 216
SaqAI TTAA 2 cut(s) 207, 231
SatI GCNGC 3 cut(s) 98, 126, 300
Sau3AI GATC 3 cut(s) 216, 323, 387
ScrFI CCNGG 2 cut(s) 80, 308
SetI ASST 2 cut(s) 111, 359
SfaNI GCATC 2 cut(s) 14, 347
SfcI CTRYAG 1 cut(s) 98
SphI GCATGC 1 cut(s) 97
Sse9I AATT 4 cut(s) 71, 183, 228, 347
SspMI CTAG 2 cut(s) 129, 203
StyD4I CCNGG 2 cut(s) 78, 306
TaaI ACNGT 1 cut(s) 374
TaqI TCGA 1 cut(s) 390
TasI AATT 4 cut(s) 71, 183, 228, 347
TfiI GAWTC 2 cut(s) 13, 132
Tru1I TTAA 2 cut(s) 207, 231
Tru9I TTAA 2 cut(s) 207, 231
TseI GCWGC 3 cut(s) 97, 125, 299
TspDTI ATGAA 1 cut(s) 348
Van91I CCANNNNNTGG 1 cut(s) 284
XapI RAATTY 2 cut(s) 71, 347
XceI RCATGY 3 cut(s) 97, 276, 383
XspI CTAG 2 cut(s) 129, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.