AT1G67910

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
25471288 .. 25472577
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G67910.2

Sequence Viewer

Length: 276 bp
ATGGAGAAGGTGCAACAAATGACAAACAACAAAGGAATCATGAAGGTTGAAATTCATAGCCATTTCAATTCTGCGGTGGAAGTGGGTTCCCGTGGGCTATCTCGTCAGACAAGCATGACCAAGACCAACTGCCTTTGCTCACCAACCACTCACCCTGGTTCTTTCCGGTGTAGGATTCACCGTTCTCTTTCGTTGCAACGTACCAAGAGTATCGAGGCTGCATCTCTATTGGATTCTCCACCAAAGCCAGCGGATTCCCCTAGTACCGCTACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

9.94

Weight (kDa)

9.81

Isoelectric Point (pI)

53.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013376)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 74, 251, 267
AcsI RAATTY 1 cut(s) 51
AfaI GTAC 2 cut(s) 202, 265
AgsI TTSAA 2 cut(s) 50, 67
AjnI CCWGG 1 cut(s) 154
AloI GAACNNNNNNTCC 2 cut(s) 166, 198
ApeKI GCWGC 1 cut(s) 218
ApoI RAATTY 1 cut(s) 51
AsuHPI GGTGA 3 cut(s) 132, 143, 170
BbvI GCAGC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 156
BfaI CTAG 1 cut(s) 261
BisI GCNGC 1 cut(s) 219
BlsI GCNGC 1 cut(s) 220
Bme1390I CCNGG 1 cut(s) 156
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 156
BmsI GCATC 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 91, 154
BsaWI WCCGGW 1 cut(s) 165
BseBI CCWGG 1 cut(s) 156
BseDI CCNNGG 2 cut(s) 91, 154
BseXI GCAGC 1 cut(s) 205
BsiSI CCGG 1 cut(s) 166
BspACI CCGC 3 cut(s) 74, 251, 267
BspHI TCATGA 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 88
BssECI CCNNGG 2 cut(s) 91, 154
Bst2UI CCWGG 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 182
BstC8I GCNNGC 1 cut(s) 249
BstDSI CCRYGG 1 cut(s) 91
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstV1I GCAGC 1 cut(s) 205
BtgI CCRYGG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 249
CciI TCATGA 1 cut(s) 39
Csp6I GTAC 2 cut(s) 201, 264
CviAII CATG 2 cut(s) 40, 115
CviJI RGCY 4 cut(s) 60, 97, 218, 247
CviKI_1 RGCY 4 cut(s) 60, 97, 218, 247
CviQI GTAC 2 cut(s) 201, 264
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 2 cut(s) 43, 118
FaiI YATR 4 cut(s) 41, 57, 116, 274
FatI CATG 2 cut(s) 39, 114
Fnu4HI GCNGC 1 cut(s) 219
Fsp4HI GCNGC 1 cut(s) 219
FspBI CTAG 1 cut(s) 261
GluI GCNGC 1 cut(s) 219
HapII CCGG 1 cut(s) 166
Hin1II CATG 2 cut(s) 43, 118
HinfI GANTC 4 cut(s) 36, 175, 233, 254
HpaII CCGG 1 cut(s) 166
HphI GGTGA 3 cut(s) 132, 143, 170
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 37
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 13, 196, 221
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 2 cut(s) 43, 118
LpnPI CCDG 4 cut(s) 141, 168, 179, 261
Lsp1109I GCAGC 1 cut(s) 205
LweI GCATC 1 cut(s) 230
MaeI CTAG 1 cut(s) 261
MaeII ACGT 1 cut(s) 199
MluCI AATT 2 cut(s) 51, 67
MnlI CCTC 1 cut(s) 208
MspA1I CMGCKG 1 cut(s) 251
MspI CCGG 1 cut(s) 166
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NlaIII CATG 2 cut(s) 43, 118
NlaIV GGNNCC 1 cut(s) 88
PagI TCATGA 1 cut(s) 39
PfeI GAWTC 4 cut(s) 36, 175, 233, 254
PkrI GCNGC 1 cut(s) 220
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 88
RsaI GTAC 2 cut(s) 202, 265
RsaNI GTAC 2 cut(s) 201, 264
SatI GCNGC 1 cut(s) 219
ScrFI CCNGG 1 cut(s) 156
SetI ASST 3 cut(s) 12, 48, 202
SfaNI GCATC 1 cut(s) 230
Sse9I AATT 2 cut(s) 51, 67
SsiI CCGC 3 cut(s) 74, 251, 267
SspMI CTAG 1 cut(s) 261
StyD4I CCNGG 1 cut(s) 154
TaaI ACNGT 1 cut(s) 182
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 213
TasI AATT 2 cut(s) 51, 67
TfiI GAWTC 4 cut(s) 36, 175, 233, 254
TseI GCWGC 1 cut(s) 218
TspDTI ATGAA 2 cut(s) 44, 56
XapI RAATTY 1 cut(s) 51
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.