AT3G17150

Plant invertase/pectin methylesterase inhibitor

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
5847258 .. 5848195
938 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G17150.1

Sequence Viewer

Length: 555 bp
ATGCACTATCAAATAAAAACAATGATGAAATTATTCTCTATTTTTGTCGTATTTATGCAAATCCAAGTAGCATTGTCGTCTCAACCAATTCGGTATGCTACGGAACCTAAGCCCATACAAGAACTCTGCAAATTTAACATTAATCCAAGCCTCTGCGTCTCTACTCTCAATCTTGATCCTAGAAGCAAGAACTCAAATTTACGAGAGCTTGCGTGGATCTCTATCGATGCGACTTCAAACAAAGTCAACAAAATGTTAAACTATCTCATCTCCGTCTCTAAGAACATCAAAGACCGTGAAGACTTAAAGAAGTACAAAACTTGCATTGATGACTATGGCACGGCGGCTCGTAGGTTTTTACCGGCGGCGTTGGATGATCTTAAAGCTGGGTTCTTTTCTCTAGCGAAGTCTGATATGGAAAGTGTTGTGTCGATACCCGATCATTGTGAGGCGCAATTCGGTGGGAGTTCACCGTTGACGGGACGTAACAAAGCCACTCATGATATCGCTAATATGACTGCTGACATCATAAGATATCTTTTTGGCAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

184

Amino Acids

20.75

Weight (kDa)

9.02

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 39 - 162 6.9e-15 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017878)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 344, 365
AclWI GGATC 2 cut(s) 170, 224
AcsI RAATTY 2 cut(s) 131, 196
AfaI GTAC 1 cut(s) 314
AfiI CCNNNNNNNGG 1 cut(s) 479
AgsI TTSAA 1 cut(s) 237
AluBI AGCT 2 cut(s) 208, 386
AluI AGCT 2 cut(s) 208, 386
Alw26I GTCTC 3 cut(s) 84, 163, 280
AlwI GGATC 2 cut(s) 170, 224
ApoI RAATTY 2 cut(s) 131, 196
AseI ATTAAT 1 cut(s) 141
Asp700I GAANNNNTTC 1 cut(s) 32
AspLEI GCGC 1 cut(s) 454
AsuHPI GGTGA 1 cut(s) 462
BbsI GAAGAC 1 cut(s) 306
BceAI ACGGC 1 cut(s) 357
BcoDI GTCTC 3 cut(s) 84, 163, 280
BfaI CTAG 2 cut(s) 180, 401
BisI GCNGC 2 cut(s) 345, 366
BlsI GCNGC 2 cut(s) 346, 367
BmiI GGNNCC 1 cut(s) 105
BmsI GCATC 1 cut(s) 217
BpiI GAAGAC 1 cut(s) 306
Bpu10I CCTNAGC 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 225
BsaBI GATNNNNATC 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 479
Bse118I RCCGGY 1 cut(s) 361
Bse8I GATNNNNATC 1 cut(s) 221
BseCI ATCGAT 1 cut(s) 225
BseGI GGATG 1 cut(s) 379
BseJI GATNNNNATC 1 cut(s) 221
BseLI CCNNNNNNNGG 1 cut(s) 479
BseYI CCCAGC 1 cut(s) 386
BshVI ATCGAT 1 cut(s) 225
BsiSI CCGG 1 cut(s) 362
BslFI GGGAC 1 cut(s) 495
BslI CCNNNNNNNGG 1 cut(s) 479
BsmAI GTCTC 3 cut(s) 84, 163, 280
BsmBI CGTCTC 3 cut(s) 84, 163, 280
BsmFI GGGAC 1 cut(s) 495
Bsp143I GATC 4 cut(s) 175, 216, 376, 439
BspACI CCGC 2 cut(s) 344, 365
BspDI ATCGAT 1 cut(s) 225
BspHI TCATGA 1 cut(s) 499
BspLI GGNNCC 1 cut(s) 105
BspPI GGATC 2 cut(s) 170, 224
BsrFI RCCGGY 1 cut(s) 361
BssAI RCCGGY 1 cut(s) 361
BssMI GATC 4 cut(s) 175, 216, 376, 439
Bst4CI ACNGT 2 cut(s) 296, 474
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 108, 279
BstF5I GGATG 1 cut(s) 379
BstHHI GCGC 1 cut(s) 454
BstKTI GATC 4 cut(s) 178, 219, 379, 442
BstMAI GTCTC 3 cut(s) 84, 163, 280
BstMBI GATC 4 cut(s) 175, 216, 376, 439
BstV2I GAAGAC 1 cut(s) 306
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
Bsu15I ATCGAT 1 cut(s) 225
BsuTUI ATCGAT 1 cut(s) 225
BtsCI GGATG 1 cut(s) 379
Cac8I GCNNGC 1 cut(s) 210
CciI TCATGA 1 cut(s) 499
CfoI GCGC 1 cut(s) 454
Cfr10I RCCGGY 1 cut(s) 361
ClaI ATCGAT 1 cut(s) 225
CseI GACGC 1 cut(s) 145
Csp6I GTAC 1 cut(s) 313
CviAII CATG 1 cut(s) 500
CviJI RGCY 6 cut(s) 112, 150, 208, 347, 386, 494
CviKI_1 RGCY 6 cut(s) 112, 150, 208, 347, 386, 494
CviQI GTAC 1 cut(s) 313
DdeI CTNAG 2 cut(s) 108, 279
DpnI GATC 4 cut(s) 177, 218, 378, 441
DpnII GATC 4 cut(s) 175, 216, 376, 439
Eco32I GATATC 2 cut(s) 505, 536
EcoRV GATATC 2 cut(s) 505, 536
Esp3I CGTCTC 3 cut(s) 84, 163, 280
FaeI CATG 1 cut(s) 503
FaiI YATR 8 cut(s) 56, 96, 116, 336, 416, 501, 515, 530
FaqI GGGAC 1 cut(s) 495
FatI CATG 1 cut(s) 499
Fnu4HI GCNGC 2 cut(s) 345, 366
FokI GGATG 1 cut(s) 386
Fsp4HI GCNGC 2 cut(s) 345, 366
FspBI CTAG 2 cut(s) 180, 401
GlaI GCGC 1 cut(s) 453
GluI GCNGC 2 cut(s) 345, 366
GsaI CCCAGC 1 cut(s) 390
HapII CCGG 1 cut(s) 362
HgaI GACGC 1 cut(s) 145
HhaI GCGC 1 cut(s) 454
Hin1II CATG 1 cut(s) 503
Hin6I GCGC 1 cut(s) 452
HinP1I GCGC 1 cut(s) 452
HincII GTYRAC 2 cut(s) 247, 477
HindII GTYRAC 2 cut(s) 247, 477
HpaII CCGG 1 cut(s) 362
HphI GGTGA 1 cut(s) 462
Hpy166II GTNNAC 3 cut(s) 247, 470, 477
Hpy188I TCNGA 1 cut(s) 412
Hpy188III TCNNGA 2 cut(s) 173, 500
Hpy8I GTNNAC 3 cut(s) 247, 470, 477
HpyCH4III ACNGT 2 cut(s) 296, 474
HpyCH4IV ACGT 1 cut(s) 484
HpyCH4V TGCA 4 cut(s) 4, 58, 129, 324
HpyF3I CTNAG 2 cut(s) 108, 279
HpySE526I ACGT 1 cut(s) 484
Hsp92II CATG 1 cut(s) 503
HspAI GCGC 1 cut(s) 452
Kzo9I GATC 4 cut(s) 175, 216, 376, 439
LpnPI CCDG 2 cut(s) 372, 375
LweI GCATC 1 cut(s) 217
MaeI CTAG 2 cut(s) 180, 401
MaeII ACGT 1 cut(s) 484
MaeIII GTNAC 1 cut(s) 485
MalI GATC 4 cut(s) 177, 218, 378, 441
MboI GATC 4 cut(s) 175, 216, 376, 439
MboII GAAGA 1 cut(s) 311
MflI RGATCY 1 cut(s) 216
MluCI AATT 6 cut(s) 29, 87, 131, 196, 455, 550
MmeI TCCRAC 1 cut(s) 351
MnlI CCTC 2 cut(s) 161, 442
MroXI GAANNNNTTC 1 cut(s) 32
MseI TTAA 6 cut(s) 135, 141, 257, 305, 381, 553
MspI CCGG 1 cut(s) 362
NdeII GATC 4 cut(s) 175, 216, 376, 439
NlaIII CATG 1 cut(s) 503
NlaIV GGNNCC 1 cut(s) 105
PagI TCATGA 1 cut(s) 499
PdmI GAANNNNTTC 1 cut(s) 32
PkrI GCNGC 2 cut(s) 346, 367
PshBI ATTAAT 1 cut(s) 141
PspFI CCCAGC 1 cut(s) 386
PspN4I GGNNCC 1 cut(s) 105
PsuI RGATCY 1 cut(s) 216
RsaI GTAC 1 cut(s) 314
RsaNI GTAC 1 cut(s) 313
SaqAI TTAA 6 cut(s) 135, 141, 257, 305, 381, 553
SatI GCNGC 2 cut(s) 345, 366
Sau3AI GATC 4 cut(s) 175, 216, 376, 439
SetI ASST 5 cut(s) 109, 210, 356, 388, 487
SfaNI GCATC 1 cut(s) 217
Sse9I AATT 6 cut(s) 29, 87, 131, 196, 455, 550
SsiI CCGC 2 cut(s) 344, 365
SspMI CTAG 2 cut(s) 180, 401
TaaI ACNGT 2 cut(s) 296, 474
TaiI ACGT 1 cut(s) 487
TaqI TCGA 2 cut(s) 225, 431
TasI AATT 6 cut(s) 29, 87, 131, 196, 455, 550
TatI WGTACW 1 cut(s) 312
TauI GCSGC 2 cut(s) 347, 368
Tru1I TTAA 6 cut(s) 135, 141, 257, 305, 381, 553
Tru9I TTAA 6 cut(s) 135, 141, 257, 305, 381, 553
TspDTI ATGAA 1 cut(s) 41
TspGWI ACGGA 2 cut(s) 116, 262
VspI ATTAAT 1 cut(s) 141
XapI RAATTY 2 cut(s) 131, 196
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 2 cut(s) 180, 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.