Rmu_co8060982.1_g000001

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8060982.1
OG0017878
Physical Location & Seq
Reverse (-)
52 .. 471
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8060982.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atgaaaaaggagtatcatattgccgggggtttcttgtcgaatgatcttagcctcattgagcaaacatgcaacaaaacaccacaccacgatctttgtgtctctgctcttacctcgatcactgagagtgccgatgcaaatgtcaaaggctcagccttcataatggcagatgttatacttagaatcgctgcaaatgatgctctaaaccaaatccaggggatgctagtgcacaacccagaagacaaactcttaaacaactatgcaagaaattacatagcaaccatacaacttgacattgaatgcagcaagaaatccattactagtcgggacaataagtcggcagagcaaagcatgaatgatgctatctctcatgctaattcatgcgaatggggttttccaggcagatctcctctgatatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

139

Amino Acids

15.3

Weight (kDa)

5.65

Isoelectric Point (pI)

52.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017878)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G17150 AT3G17152
fragaria_vesca FvH4_4g25210
rosa_chinensis RchiOBHm_Chr4g0432401
rosa_multiflora Rmu_co8060982.1_g000001 Rmu_sc0001084.1_g000025 Rmu_sc0016445.1_g000009
rosa_rugosa Rorug04G0258200
rosa_samantha Rh4BG321700 Rh4CG336800 Rh4DG317300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 211
AgsI TTSAA 1 cut(s) 296
AhdI GACNNNNNGTC 1 cut(s) 331
AhlI ACTAGT 1 cut(s) 317
AjnI CCWGG 2 cut(s) 210, 394
Alw21I GWGCWC 1 cut(s) 228
Alw26I GTCTC 1 cut(s) 103
Alw44I GTGCAC 1 cut(s) 224
ApaLI GTGCAC 1 cut(s) 224
ApeKI GCWGC 2 cut(s) 185, 300
AsuC2I CCSGG 1 cut(s) 25
BaeGI GKGCMC 1 cut(s) 228
BbsI GAAGAC 1 cut(s) 243
Bbv12I GWGCWC 1 cut(s) 228
BbvI GCAGC 2 cut(s) 172, 312
BciT130I CCWGG 2 cut(s) 212, 396
BcnI CCSGG 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 103
BcuI ACTAGT 1 cut(s) 317
BfaI CTAG 2 cut(s) 221, 318
BglII AGATCT 1 cut(s) 401
BisI GCNGC 2 cut(s) 186, 301
BlpI GCTNAGC 1 cut(s) 148
BlsI GCNGC 2 cut(s) 187, 302
Bme1390I CCNGG 3 cut(s) 25, 212, 396
BmeRI GACNNNNNGTC 1 cut(s) 331
BmrFI CCNGG 3 cut(s) 25, 212, 396
BmsI GCATC 4 cut(s) 121, 184, 207, 346
BpiI GAAGAC 1 cut(s) 243
Bpu1102I GCTNAGC 1 cut(s) 148
BpuMI CCSGG 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 24, 211
Bsc4I CCNNNNNNNGG 1 cut(s) 211
BseBI CCWGG 2 cut(s) 212, 396
BseDI CCNNGG 2 cut(s) 24, 211
BseGI GGATG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 211
BseMII CTCAG 2 cut(s) 111, 162
BseRI GAGGAG 1 cut(s) 396
BseSI GKGCMC 1 cut(s) 228
BseXI GCAGC 2 cut(s) 172, 312
BsiHKAI GWGCWC 1 cut(s) 228
BsiSI CCGG 1 cut(s) 24
BslFI GGGAC 1 cut(s) 338
BslI CCNNNNNNNGG 1 cut(s) 211
BsmAI GTCTC 1 cut(s) 103
BsmFI GGGAC 1 cut(s) 338
BsmI GAATGC 1 cut(s) 302
Bsp1286I GDGCHC 1 cut(s) 228
Bsp143I GATC 4 cut(s) 43, 88, 114, 401
Bsp1720I GCTNAGC 1 cut(s) 148
BspCNI CTCAG 2 cut(s) 112, 161
BssECI CCNNGG 2 cut(s) 24, 211
BssMI GATC 4 cut(s) 43, 88, 114, 401
Bst2UI CCWGG 2 cut(s) 212, 396
BstAPI GCANNNNNTGC 1 cut(s) 194
BstDEI CTNAG 4 cut(s) 47, 120, 148, 176
BstF5I GGATG 1 cut(s) 222
BstKTI GATC 4 cut(s) 46, 91, 117, 404
BstMAI GTCTC 1 cut(s) 103
BstMBI GATC 4 cut(s) 43, 88, 114, 401
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 2 cut(s) 212, 396
BstNSI RCATGY 1 cut(s) 69
BstSCI CCNGG 3 cut(s) 23, 210, 394
BstSLI GKGCMC 1 cut(s) 228
BstV1I GCAGC 2 cut(s) 172, 312
BstV2I GAAGAC 1 cut(s) 243
BstX2I RGATCY 1 cut(s) 401
BstYI RGATCY 1 cut(s) 401
BtsCI GGATG 1 cut(s) 222
BtsIMutI CAGTG 1 cut(s) 117
CspCI CAANNNNNGTGG 2 cut(s) 74, 109
CviAII CATG 4 cut(s) 66, 349, 368, 378
CviJI RGCY 3 cut(s) 51, 147, 152
CviKI_1 RGCY 3 cut(s) 51, 147, 152
DdeI CTNAG 4 cut(s) 47, 120, 148, 176
DpnI GATC 4 cut(s) 45, 90, 116, 403
DpnII GATC 4 cut(s) 43, 88, 114, 401
DriI GACNNNNNGTC 1 cut(s) 331
Eam1105I GACNNNNNGTC 1 cut(s) 331
EcoRII CCWGG 2 cut(s) 210, 394
FaeI CATG 4 cut(s) 69, 352, 371, 381
FaqI GGGAC 1 cut(s) 338
FatI CATG 4 cut(s) 65, 348, 367, 377
Fnu4HI GCNGC 2 cut(s) 186, 301
FokI GGATG 1 cut(s) 229
Fsp4HI GCNGC 2 cut(s) 186, 301
FspBI CTAG 2 cut(s) 221, 318
GluI GCNGC 2 cut(s) 186, 301
HapII CCGG 1 cut(s) 24
Hin1II CATG 4 cut(s) 69, 352, 371, 381
HinfI GANTC 1 cut(s) 180
HpaII CCGG 1 cut(s) 24
Hpy166II GTNNAC 1 cut(s) 226
Hpy188I TCNGA 1 cut(s) 411
Hpy188III TCNNGA 1 cut(s) 323
Hpy8I GTNNAC 1 cut(s) 226
HpyAV CCTTC 1 cut(s) 163
HpyCH4V TGCA 6 cut(s) 69, 134, 188, 226, 260, 300
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 4 cut(s) 47, 120, 148, 176
Hsp92II CATG 4 cut(s) 69, 352, 371, 381
Kzo9I GATC 4 cut(s) 43, 88, 114, 401
LpnPI CCDG 6 cut(s) 37, 197, 224, 246, 381, 408
Lsp1109I GCAGC 2 cut(s) 172, 312
LweI GCATC 4 cut(s) 121, 184, 207, 346
MaeI CTAG 2 cut(s) 221, 318
MalI GATC 4 cut(s) 45, 90, 116, 403
MboI GATC 4 cut(s) 43, 88, 114, 401
MboII GAAGA 1 cut(s) 248
MflI RGATCY 1 cut(s) 401
MhlI GDGCHC 1 cut(s) 228
MluCI AATT 2 cut(s) 265, 373
MnlI CCTC 3 cut(s) 62, 121, 417
MseI TTAA 1 cut(s) 248
MslI CAYNNNNRTG 1 cut(s) 382
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 3 cut(s) 25, 212, 396
Mva1269I GAATGC 1 cut(s) 302
MvaI CCWGG 2 cut(s) 212, 396
MwoI GCNNNNNNNGC 1 cut(s) 194
NciI CCSGG 1 cut(s) 25
NdeII GATC 4 cut(s) 43, 88, 114, 401
NlaIII CATG 4 cut(s) 69, 352, 371, 381
NspI RCATGY 1 cut(s) 69
PctI GAATGC 1 cut(s) 302
PfeI GAWTC 1 cut(s) 180
PkrI GCNGC 2 cut(s) 187, 302
Psp6I CCWGG 2 cut(s) 210, 394
PspGI CCWGG 2 cut(s) 210, 394
PsuI RGATCY 1 cut(s) 401
RseI CAYNNNNRTG 1 cut(s) 382
SaqAI TTAA 1 cut(s) 248
SatI GCNGC 2 cut(s) 186, 301
Sau3AI GATC 4 cut(s) 43, 88, 114, 401
ScrFI CCNGG 3 cut(s) 25, 212, 396
SduI GDGCHC 1 cut(s) 228
SetI ASST 1 cut(s) 113
SfaNI GCATC 4 cut(s) 121, 184, 207, 346
SmiMI CAYNNNNRTG 1 cut(s) 382
SpeI ACTAGT 1 cut(s) 317
Sse9I AATT 2 cut(s) 265, 373
SspMI CTAG 2 cut(s) 221, 318
StyD4I CCNGG 3 cut(s) 23, 210, 394
TaqI TCGA 2 cut(s) 38, 113
TasI AATT 2 cut(s) 265, 373
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 248
Tru9I TTAA 1 cut(s) 248
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 185, 300
TspDTI ATGAA 4 cut(s) 17, 145, 365, 366
TspRI CASTG 1 cut(s) 124
VneI GTGCAC 1 cut(s) 224
XceI RCATGY 1 cut(s) 69
XspI CTAG 2 cut(s) 221, 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.