Rh4DG317300

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0017878
Physical Location & Seq
Forward (+)
54005881 .. 54006156
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG317300.1

Sequence Viewer

Length: 276 bp
ATGGCATATGTTATACTTAGGATCGCTGCAAATGATGCTCTAAACCAAATCCAGGAGATGCTAGCGCACAACCCAGAAGACAAACTCTTAAACGACTATGTAAGAAATTACATAGCAATCATACAACTTGACATTGAACGCAGCAAGAAATCCATTACTAGTCGGGACTATAAGTCGGCAGAGCAAAGCATGAATGATGCTATCTCTCACGCTCATTCATGCGAAGGGTTTTCCAGGCAGATCTCCTCTAATATATTAGAACACACTTGTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

91

Amino Acids

10.32

Weight (kDa)

5.71

Isoelectric Point (pI)

54.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017878)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G17150 AT3G17152
fragaria_vesca FvH4_4g25210
rosa_chinensis RchiOBHm_Chr4g0432401
rosa_multiflora Rmu_co8060982.1_g000001 Rmu_sc0001084.1_g000025 Rmu_sc0016445.1_g000009
rosa_rugosa Rorug04G0258200
rosa_samantha Rh4BG321700 Rh4CG336800 Rh4DG317300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 137
AhdI GACNNNNNGTC 1 cut(s) 172
AhlI ACTAGT 1 cut(s) 158
AjnI CCWGG 2 cut(s) 51, 233
AleI CACNNNNGTG 1 cut(s) 267
AlwI GGATC 1 cut(s) 29
ApeKI GCWGC 2 cut(s) 26, 141
AspLEI GCGC 1 cut(s) 67
AsuNHI GCTAGC 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 84
BbvI GCAGC 2 cut(s) 13, 153
BciT130I CCWGG 2 cut(s) 53, 235
BcuI ACTAGT 1 cut(s) 158
BfaI CTAG 2 cut(s) 62, 159
BglII AGATCT 1 cut(s) 240
BisI GCNGC 2 cut(s) 27, 142
BlsI GCNGC 2 cut(s) 28, 143
Bme1390I CCNGG 2 cut(s) 53, 235
BmeRI GACNNNNNGTC 1 cut(s) 172
BmrFI CCNGG 2 cut(s) 53, 235
BmsI GCATC 3 cut(s) 25, 48, 187
BmtI GCTAGC 1 cut(s) 65
BpiI GAAGAC 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseBI CCWGG 2 cut(s) 53, 235
BseLI CCNNNNNNNGG 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 235
BseXI GCAGC 2 cut(s) 13, 153
BslFI GGGAC 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 179
Bsp143I GATC 2 cut(s) 21, 240
BspOI GCTAGC 1 cut(s) 65
BspPI GGATC 1 cut(s) 29
BssMI GATC 2 cut(s) 21, 240
Bst2UI CCWGG 2 cut(s) 53, 235
BstAPI GCANNNNNTGC 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 17
BstHHI GCGC 1 cut(s) 67
BstKTI GATC 2 cut(s) 24, 243
BstMBI GATC 2 cut(s) 21, 240
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNI CCWGG 2 cut(s) 53, 235
BstSCI CCNGG 2 cut(s) 51, 233
BstV1I GCAGC 2 cut(s) 13, 153
BstV2I GAAGAC 1 cut(s) 84
BstX2I RGATCY 1 cut(s) 240
BstYI RGATCY 1 cut(s) 240
Cac8I GCNNGC 1 cut(s) 63
CfoI GCGC 1 cut(s) 67
CviAII CATG 2 cut(s) 190, 219
CviJI RGCY 1 cut(s) 273
CviKI_1 RGCY 1 cut(s) 273
DdeI CTNAG 1 cut(s) 17
DpnI GATC 2 cut(s) 23, 242
DpnII GATC 2 cut(s) 21, 240
DriI GACNNNNNGTC 1 cut(s) 172
Eam1105I GACNNNNNGTC 1 cut(s) 172
EcoRII CCWGG 2 cut(s) 51, 233
FaeI CATG 2 cut(s) 193, 222
FaqI GGGAC 1 cut(s) 179
FatI CATG 2 cut(s) 189, 218
FauNDI CATATG 1 cut(s) 7
Fnu4HI GCNGC 2 cut(s) 27, 142
Fsp4HI GCNGC 2 cut(s) 27, 142
FspBI CTAG 2 cut(s) 62, 159
GlaI GCGC 1 cut(s) 66
GluI GCNGC 2 cut(s) 27, 142
HhaI GCGC 1 cut(s) 67
Hin1II CATG 2 cut(s) 193, 222
Hin6I GCGC 1 cut(s) 65
HinP1I GCGC 1 cut(s) 65
Hpy188III TCNNGA 1 cut(s) 164
HpyAV CCTTC 1 cut(s) 218
HpyCH4V TGCA 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 2 cut(s) 193, 222
HspAI GCGC 1 cut(s) 65
Kzo9I GATC 2 cut(s) 21, 240
LpnPI CCDG 5 cut(s) 38, 65, 87, 220, 247
Lsp1109I GCAGC 2 cut(s) 13, 153
LweI GCATC 3 cut(s) 25, 48, 187
MaeI CTAG 2 cut(s) 62, 159
MalI GATC 2 cut(s) 23, 242
MboI GATC 2 cut(s) 21, 240
MboII GAAGA 1 cut(s) 89
MflI RGATCY 1 cut(s) 240
MluCI AATT 1 cut(s) 106
MnlI CCTC 1 cut(s) 256
MseI TTAA 1 cut(s) 89
MslI CAYNNNNRTG 1 cut(s) 267
MspR9I CCNGG 2 cut(s) 53, 235
MvaI CCWGG 2 cut(s) 53, 235
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeI CATATG 1 cut(s) 7
NdeII GATC 2 cut(s) 21, 240
NheI GCTAGC 1 cut(s) 61
NlaIII CATG 2 cut(s) 193, 222
OliI CACNNNNGTG 1 cut(s) 267
PfoI TCCNGGA 1 cut(s) 51
PkrI GCNGC 2 cut(s) 28, 143
Psp6I CCWGG 2 cut(s) 51, 233
PspGI CCWGG 2 cut(s) 51, 233
PsuI RGATCY 1 cut(s) 240
RseI CAYNNNNRTG 1 cut(s) 267
SaqAI TTAA 1 cut(s) 89
SatI GCNGC 2 cut(s) 27, 142
Sau3AI GATC 2 cut(s) 21, 240
ScrFI CCNGG 2 cut(s) 53, 235
SfaNI GCATC 3 cut(s) 25, 48, 187
SmiMI CAYNNNNRTG 1 cut(s) 267
SpeI ACTAGT 1 cut(s) 158
Sse9I AATT 1 cut(s) 106
SspMI CTAG 2 cut(s) 62, 159
StyD4I CCNGG 2 cut(s) 51, 233
TasI AATT 1 cut(s) 106
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TseI GCWGC 2 cut(s) 26, 141
TspDTI ATGAA 2 cut(s) 206, 207
XspI CTAG 2 cut(s) 62, 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.