AT3G27027

Protein of unknown function (DUF3339)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0018714
Physical Location & Seq
Forward (+)
9971772 .. 9972230
459 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G27027.1

Sequence Viewer

Length: 210 bp
ATGAGCACGGATTGGGGACCTGTGATTGTAGCGGTGTCTCTATTCATCCTACTCTCACCAGGACTACTATTCCAGCTTCCCGCAAGAACGAGAGTGGTTGAATTCGGAAACATGACCACAAGCGGTATAGCCATTTTGGTTCACGCATTTATATACTTCTGTATACTAACAATCTTGGTGATTGCTATACAAATTCACATCCATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3339

Protein Analysis

69

Amino Acids

7.64

Weight (kDa)

6.81

Isoelectric Point (pI)

44.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3339 PF11820 3 - 68 1.8e-32 Protein of unknown function (DUF3339)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018714)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27027 AT5G40980
malus_domestica MD09G1009300.v1.1 MD17G1001100.v1.1
prunus_persica Prupe.3G307600_v2.0.a1
pyrus_communis pycom111g00750
rosa_multiflora Rmu_sc0000998.1_g000004
rosa_samantha Rh2DG692000
rosa_wichuraiana Rw2G054680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 163
AciI CCGC 3 cut(s) 32, 81, 123
AcsI RAATTY 2 cut(s) 101, 192
AgsI TTSAA 1 cut(s) 101
AjnI CCWGG 1 cut(s) 58
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 42
ApoI RAATTY 2 cut(s) 101, 192
AspS9I GGNCC 1 cut(s) 17
AsuHPI GGTGA 2 cut(s) 48, 190
AvaII GGWCC 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 60
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 60
BseGI GGATG 2 cut(s) 45, 198
BsiHKAI GWGCWC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 42
BsmFI GGGAC 1 cut(s) 30
Bsp1286I GDGCHC 1 cut(s) 8
BspACI CCGC 3 cut(s) 32, 81, 123
BspLI GGNNCC 1 cut(s) 18
BssNAI GTATAC 1 cut(s) 164
Bst1107I GTATAC 1 cut(s) 164
Bst2UI CCWGG 1 cut(s) 60
BstF5I GGATG 2 cut(s) 45, 198
BstMAI GTCTC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 58
BstZ17I GTATAC 1 cut(s) 164
BtsCI GGATG 2 cut(s) 45, 198
Cfr13I GGNCC 1 cut(s) 17
CviAII CATG 1 cut(s) 112
CviJI RGCY 2 cut(s) 76, 131
CviKI_1 RGCY 2 cut(s) 76, 131
Eco47I GGWCC 1 cut(s) 17
EcoO109I RGGNCCY 1 cut(s) 17
EcoRI GAATTC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 58
FaeI CATG 1 cut(s) 115
FaiI YATR 6 cut(s) 113, 128, 152, 154, 164, 188
FaqI GGGAC 1 cut(s) 30
FatI CATG 1 cut(s) 111
FauI CCCGC 1 cut(s) 88
FblI GTMKAC 1 cut(s) 163
FokI GGATG 2 cut(s) 32, 185
Hin1II CATG 1 cut(s) 115
HphI GGTGA 2 cut(s) 48, 190
Hpy166II GTNNAC 2 cut(s) 142, 164
Hpy188I TCNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 142, 164
Hsp92II CATG 1 cut(s) 115
LpnPI CCDG 4 cut(s) 33, 45, 72, 86
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 101, 192
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
NlaIII CATG 1 cut(s) 115
NlaIV GGNNCC 1 cut(s) 18
PpuMI RGGWCCY 1 cut(s) 17
Psp5II RGGWCCY 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 17
PspPPI RGGWCCY 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 60
SduI GDGCHC 1 cut(s) 8
SetI ASST 2 cut(s) 22, 78
SinI GGWCC 1 cut(s) 17
Sse9I AATT 2 cut(s) 101, 192
SsiI CCGC 3 cut(s) 32, 81, 123
StyD4I CCNGG 1 cut(s) 58
TasI AATT 2 cut(s) 101, 192
TspDTI ATGAA 1 cut(s) 34
TspGWI ACGGA 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 17
XapI RAATTY 2 cut(s) 101, 192
XmiI GTMKAC 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.