Prupe.3G307600_v2.0.a1

Protein of unknown function (DUF3339)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
26827966 .. 26828178
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G307600.1

Sequence Viewer

Length: 213 bp
ATGGGTGCTGATTGGGGACCAGTCATTGTTGCTGTGGTCTTGTTCATCCTCCTTTCGCCAGGGCTGCTATTCCAATTACCGGCAAGAACTAGGGTAATGGAGTTCGGAAACATGATGACAAGTGGGATTGCTATTCTGGTTCATGCTGTCATATACTTCTGCATACTGACCATCTTGATCATAGCAATTGGTATTCACATACATGTCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.62

Weight (kDa)

6.81

Isoelectric Point (pI)

35.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018714)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27027 AT5G40980
malus_domestica MD09G1009300.v1.1 MD17G1001100.v1.1
prunus_persica Prupe.3G307600_v2.0.a1
pyrus_communis pycom111g00750
rosa_multiflora Rmu_sc0000998.1_g000004
rosa_samantha Rh2DG692000
rosa_wichuraiana Rw2G054680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 79
AflIII ACRYGT 1 cut(s) 202
AjnI CCWGG 1 cut(s) 58
ApeKI GCWGC 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 17
AvaII GGWCC 1 cut(s) 17
BbvI GCAGC 1 cut(s) 51
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 60
BclI TGATCA 1 cut(s) 177
BfaI CTAG 1 cut(s) 90
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 60
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 59
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse118I RCCGGY 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 79
BseNI ACTGG 1 cut(s) 20
BseXI GCAGC 1 cut(s) 51
BsiSI CCGG 1 cut(s) 80
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 79
BsmFI GGGAC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 18
BsrFI RCCGGY 1 cut(s) 79
BsrI ACTGG 1 cut(s) 20
BssAI RCCGGY 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 1 cut(s) 177
Bst2UI CCWGG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 206
BstSCI CCNGG 1 cut(s) 58
BstV1I GCAGC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 45
Cfr10I RCCGGY 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 17
CviAII CATG 3 cut(s) 112, 143, 203
CviJI RGCY 1 cut(s) 64
CviKI_1 RGCY 1 cut(s) 64
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 17
EcoRII CCWGG 1 cut(s) 58
FaeI CATG 3 cut(s) 115, 146, 206
FaiI YATR 8 cut(s) 113, 144, 152, 154, 164, 182, 200, 204
FaqI GGGAC 1 cut(s) 30
FatI CATG 3 cut(s) 111, 142, 202
FbaI TGATCA 1 cut(s) 177
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 1 cut(s) 32
Fsp4HI GCNGC 1 cut(s) 65
FspBI CTAG 1 cut(s) 90
GluI GCNGC 1 cut(s) 65
HapII CCGG 1 cut(s) 80
Hin1II CATG 3 cut(s) 115, 146, 206
HpaII CCGG 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 175
HpyCH4V TGCA 1 cut(s) 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
Hsp92II CATG 3 cut(s) 115, 146, 206
Ksp22I TGATCA 1 cut(s) 177
Kzo9I GATC 1 cut(s) 177
LpnPI CCDG 5 cut(s) 33, 45, 72, 93, 122
Lsp1109I GCAGC 1 cut(s) 51
MaeI CTAG 1 cut(s) 90
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MfeI CAATTG 1 cut(s) 186
MluCI AATT 3 cut(s) 74, 186, 208
MnlI CCTC 1 cut(s) 59
MslI CAYNNNNRTG 1 cut(s) 201
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 60
MunI CAATTG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 1 cut(s) 177
NlaIII CATG 3 cut(s) 115, 146, 206
NlaIV GGNNCC 1 cut(s) 18
NspI RCATGY 1 cut(s) 206
PciI ACATGT 1 cut(s) 202
PkrI GCNGC 1 cut(s) 66
PscI ACATGT 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 201
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 60
SinI GGWCC 1 cut(s) 17
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 3 cut(s) 74, 186, 208
SspMI CTAG 1 cut(s) 90
StyD4I CCNGG 1 cut(s) 58
TasI AATT 3 cut(s) 74, 186, 208
TseI GCWGC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 34, 131
VpaK11BI GGWCC 1 cut(s) 17
XceI RCATGY 1 cut(s) 206
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.