AT3G52770

zpr3 zpr3 (little zipper 3)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
19557516 .. 19559323
1808 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G52770.1

Sequence Viewer

Length: 204 bp
ATGGAGAGGCTAAACTCGAAGCTGTTTGTTGAAAACTGTTACATAATGAAAGAGAACGAGAGACTAAGGAAGAAAGCTGAGCTTCTGAATCAAGAGAACCAACAGCTTTTGTTTCAACTCAAACAGAAACTCTCCAAAACTAAGAACTCTAACAATGGATCAAACAATGACAACAAATCAAGCTCTGCTTCTGGACAATCTTGA

Protein Analysis

67

Amino Acids

7.75

Weight (kDa)

9.67

Isoelectric Point (pI)

29.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012505)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 166
AgsI TTSAA 2 cut(s) 32, 116
AluBI AGCT 5 cut(s) 22, 77, 82, 106, 183
AluI AGCT 5 cut(s) 22, 77, 82, 106, 183
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 55
BlpI GCTNAGC 1 cut(s) 78
Bpu1102I GCTNAGC 1 cut(s) 78
BseMII CTCAG 1 cut(s) 69
BsmAI GTCTC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 158
Bsp1720I GCTNAGC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 70
BspPI GGATC 1 cut(s) 166
BssMI GATC 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 38
BstDEI CTNAG 3 cut(s) 65, 78, 141
BstKTI GATC 1 cut(s) 161
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 1 cut(s) 158
CviJI RGCY 6 cut(s) 10, 22, 77, 82, 106, 183
CviKI_1 RGCY 6 cut(s) 10, 22, 77, 82, 106, 183
DdeI CTNAG 3 cut(s) 65, 78, 141
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
FaiI YATR 1 cut(s) 44
FalI AAGNNNNNCTT 4 cut(s) 66, 98, 172, 204
FspEI CC 5 cut(s) 52, 113, 141, 148, 177
HinfI GANTC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 3 cut(s) 92, 192, 201
HpyCH4III ACNGT 1 cut(s) 38
HpyF3I CTNAG 3 cut(s) 65, 78, 141
Kzo9I GATC 1 cut(s) 158
LpnPI CCDG 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MboII GAAGA 1 cut(s) 82
NdeII GATC 1 cut(s) 158
PfeI GAWTC 1 cut(s) 88
Sau3AI GATC 1 cut(s) 158
SetI ASST 5 cut(s) 24, 79, 84, 108, 185
SgeI CNNG 4 cut(s) 28, 70, 104, 192
TaaI ACNGT 1 cut(s) 38
TaqI TCGA 1 cut(s) 17
TfiI GAWTC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.